View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0091_high_15 (Length: 212)
Name: NF0091_high_15
Description: NF0091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0091_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 8156484 - 8156368
Alignment:
Q |
1 |
cttgaatcatgttacaaagtagaagaatttctccaggggtcaatattaggtttatgagagagctagagtagtcgtatcattttaatgttagatcatccca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
T |
8156484 |
cttgaatcatgttacaaagtagaagaatttctccaggggtcaatattaggtttatgagagagttagagtagtcgtatca--ttaatgttagatcatccca |
8156387 |
T |
 |
Q |
101 |
caagtctctgtgatgatgt |
119 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
8156386 |
caagtctctgtgatgatgt |
8156368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University