View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0091_high_5 (Length: 314)
Name: NF0091_high_5
Description: NF0091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0091_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 93 - 312
Target Start/End: Complemental strand, 40514163 - 40513944
Alignment:
Q |
93 |
ctaaaatgcttttacacgttcttgttcgaatattggtatttgatcagaataagaatagagtgctaattgccttagcgcgttaccatcatcgatatttgtg |
192 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
40514163 |
ctaaaatgcttttacacgttcttgttcgaatattggtatttgaacagaataagaatagagtgctaattgccttagtgcgttaccatcatcgatatttgtg |
40514064 |
T |
 |
Q |
193 |
gccacaatacattaaccaattttttcttgttatctagattcatagttttggtcgaagagaaatttgattcttttggaaaaccagtatgggatttgataat |
292 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40514063 |
gccacaatacattaaccaattttttcttgttatctagattcatagttttggtcgaagagaaatttgattcttttggaaaaccagtatgggatttgataat |
40513964 |
T |
 |
Q |
293 |
ccaagacctgaaaggtgtgt |
312 |
Q |
|
|
|||||| ||||||||||||| |
|
|
T |
40513963 |
ccaagatctgaaaggtgtgt |
40513944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University