View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0091_low_10 (Length: 274)
Name: NF0091_low_10
Description: NF0091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0091_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 53 - 239
Target Start/End: Complemental strand, 32515157 - 32514971
Alignment:
| Q |
53 |
tggaggtctatctacaacacgaaaaaacctggaggctcaagagatttggttttgacatacataccttatgttcaccaaaatgatcaagaagaccaataag |
152 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32515157 |
tggaggtctatctacaacatgaaaaaacctggaggctcaagagatttggttttgacatacataccttatgttcaccaaaatgatcaagaagaccaataag |
32515058 |
T |
 |
| Q |
153 |
gtcacctacgatgtggtgaagagtgtaggaatcggagttgataggagaatcagagtcaccatatcctcttagatcaggtgcaacagc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32515057 |
gtcacctacgatgtggtgaagagtgtaggaatcggagttgataggagaatcagagtcaccatatcctcttagatcaggtgcaacagc |
32514971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University