View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0091_low_11 (Length: 271)
Name: NF0091_low_11
Description: NF0091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0091_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 32 - 224
Target Start/End: Original strand, 40513679 - 40513871
Alignment:
| Q |
32 |
aactctttcatagtcttctgagaatactcttgacaatactcttgttttcaaaaacttgttccttgtttcattctttcgagactttttcgaactttgttca |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40513679 |
aactctttcatagtcttctgagaatactcttgacaatactcttgttttcaaaaacttgttccttgtttcattctttcgagactttttcgaactttgttca |
40513778 |
T |
 |
| Q |
132 |
ggtatttgtgttccatcaatgtggtatttcaccttaactccacttgttgtgggaatttttgatatttcaggatcatcttcaaacctatgaaaa |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40513779 |
ggtatttgtgttccatcaatgtggtatttcaccttaactccacttgttgtgggaatttttgatatttcaggatcatcttcaaacctatgaaaa |
40513871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 229 - 271
Target Start/End: Original strand, 40513864 - 40513908
Alignment:
| Q |
229 |
tatgaaaagttcataaacttgaagactaattag--ctaaataact |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40513864 |
tatgaaaagttcataaacttgaagactaattagtactaaataact |
40513908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University