View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0091_low_12 (Length: 264)
Name: NF0091_low_12
Description: NF0091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0091_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 29 - 253
Target Start/End: Original strand, 39509980 - 39510203
Alignment:
| Q |
29 |
attttcatgtggaacattattactgcaataacgttgaaattgaaaagctttctgagaatcagatgctgctaattggaagtaaatccgaacaatattaacg |
128 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39509980 |
attttcatgtggaacattattactgcactaacgttgaaattgaaaagctttctgagaatcagatgctgctaattggaagtaaatccgaacaatattaacg |
39510079 |
T |
|
| Q |
129 |
gttcagaatcagacatgttccttatgtgtagaacaaaaatgtccgcaatattcaatattcnnnnnnnnnnnnnngactcaaacaatattcagtattcctt |
228 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39510080 |
gttcagaatcagacatgttccttatttgtagaacaaaaatgtccgcaatattcaatattc-tttttttctttttgactcaaacaatattcagtattcctt |
39510178 |
T |
|
| Q |
229 |
tcaaatttgttatttgcacgttcat |
253 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39510179 |
tcaaatttgttatttgcacgttcat |
39510203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1164 times since January 2019
Visitors: 1293