View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0091_low_14 (Length: 249)
Name: NF0091_low_14
Description: NF0091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0091_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 213
Target Start/End: Complemental strand, 50667156 - 50666964
Alignment:
| Q |
20 |
aataatatgagtatgttttgattaggttgagatgagtttggtgtgtggtaaaagggttaggcttatgaagaagtgtttttgcttaaaacttggaatggat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50667156 |
aataatatgagtatgttttgattaggttgagatgagtttggtgtgtggtaaaagggttaggcttatgaagaagtgtttttgcttaaaacttggaatggat |
50667057 |
T |
|
| Q |
120 |
gaattcaaagagggtcttatccacttgtttttaaaatgaagaattgaagaatgtttttcttgtggaggagggttaagcggaaggatgagcaaca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50667056 |
gaattcaaagagggtcttatccacttgtttttaaaatgaagaa-tgaagaatgtttttcttgtggaggagggttaagcggaaggatgagcaaca |
50666964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University