View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0091_low_16 (Length: 229)
Name: NF0091_low_16
Description: NF0091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0091_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 30412988 - 30413100
Alignment:
| Q |
35 |
aactaccatgcttttgttgtggctcttctctt-ctttcaacttgatcataaaa-aaccgattaaagtagcagccaggacaaaaataattgtttttagttt |
132 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||| |||||||||||||||||||| || | |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30412988 |
aactactatggttttgttgtggctcttctctttctttcaacttgatcataaaacaatcaattaaaatagcagccaggacaaaaataattgtttttagttt |
30413087 |
T |
 |
| Q |
133 |
tcacacgttcacat |
146 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
30413088 |
t-acacgttcacat |
30413100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 35 - 126
Target Start/End: Original strand, 30403823 - 30403916
Alignment:
| Q |
35 |
aactaccatgcttttgttgtggctcttctctt-ctttcaacttgatcataaaa-aaccgattaaagtagcagccaggacaaaaataattgtttt |
126 |
Q |
| |
|
|||||| ||| | ||||||||||||||||||| ||||||| |||||||||||| |||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30403823 |
aactactatggtcttgttgtggctcttctctttctttcaagttgatcataaaacaaccaattaaagtagcagccaggacaaaaatatttgtttt |
30403916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 112
Target Start/End: Original strand, 30410496 - 30410576
Alignment:
| Q |
35 |
aactaccatgcttttgttgtggctcttctctt-ctttcaacttgatcat--aaaaaaccgattaaagtagcagccaggaca |
112 |
Q |
| |
|
|||||| ||| ||||||||||||||| |||| |||||||||||||||| ||||||||||||| || ||||||||||||| |
|
|
| T |
30410496 |
aactactatggttttgttgtggctctattctttctttcaacttgatcataaaaaaaaccgattagagcagcagccaggaca |
30410576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 174 - 211
Target Start/End: Original strand, 30413098 - 30413135
Alignment:
| Q |
174 |
catttgcttttcttctctataattttaaggcgttgctt |
211 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
30413098 |
catttgcttttcttctctataatttcaatgcgttgctt |
30413135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 210
Target Start/End: Original strand, 30403927 - 30403963
Alignment:
| Q |
174 |
catttgcttttcttctctataattttaaggcgttgct |
210 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
30403927 |
catttgcttttcttctctataatttcaaggccttgct |
30403963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University