View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0091_low_8 (Length: 301)
Name: NF0091_low_8
Description: NF0091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0091_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 52 - 220
Target Start/End: Original strand, 39111915 - 39112083
Alignment:
| Q |
52 |
aagtcttccaccgtagcctttgccccgcaaccaacccactattcttaagttacgtatggccaagcttatttttaaaataaaaagctctttagaaaacttt |
151 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39111915 |
aagtctcccaccgtagcctttgccccgcaaccaacccactattcttaagttacgtatggccaagcttatttttaaaataaaaagctctttagaaaacttt |
39112014 |
T |
|
| Q |
152 |
ttggtatcggtcgattatgcatatagtgtattatatgattcttgtttgcttgtgttgatttgttatagt |
220 |
Q |
| |
|
||||| | |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39112015 |
ttggtgttggtcaattatgcatatagtgtattatatgattcttgtttgcttgtgttgatttgttatagt |
39112083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 698 times since January 2019
Visitors: 1282