View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0092-INSERTION-5 (Length: 120)
Name: NF0092-INSERTION-5
Description: NF0092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0092-INSERTION-5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 2e-56; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 7467683 - 7467801
Alignment:
| Q |
1 |
ttatgcatttctttggtattggcttcaggtaagaggaattgttagttttatcttttgagttgtattttcaagaaacaatttattatatcaaatcaaaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7467683 |
ttatgcatttctttggtattggcttcaggtaagaggaattgttagttttatcttttgagttttattttcaataaacaatttattatatcaaatcaaaatt |
7467782 |
T |
|
| Q |
101 |
ttaacattaagtttgtttt |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7467783 |
ttaacattaagtttgtttt |
7467801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 7481294 - 7481374
Alignment:
| Q |
1 |
ttatgcatttctttggtattggcttcaggtaagaggaattgtta-gttttatcttttgagttgtattttcaagaaacaatt |
80 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||| |||||||| |||||||| |
|
|
| T |
7481294 |
ttatgcatttctttggtgttggtttcaggtaagaggaattgttattttttatcttttgagtttcattttcaataaacaatt |
7481374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 7498088 - 7498168
Alignment:
| Q |
1 |
ttatgcatttctttggtattggcttcaggtaagaggaattgtta-gttttatcttttgagttgtattttcaagaaacaatt |
80 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||| |||||||| |||||||| |
|
|
| T |
7498088 |
ttatgcatttctttggtgttggtttcaggtaagaggaattgttattttttatcttttgagtttcattttcaataaacaatt |
7498168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 7463211 - 7463250
Alignment:
| Q |
1 |
ttatgcatttctttggtattggcttcaggtaagaggaatt |
40 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
7463211 |
ttatgcatttctttggtcttggtttcaggtaagaggaatt |
7463250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 677 times since January 2019
Visitors: 1282