View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0092-INSERTION-7 (Length: 99)
Name: NF0092-INSERTION-7
Description: NF0092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0092-INSERTION-7 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 7e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 7e-40
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 12364868 - 12364966
Alignment:
Q |
1 |
caaaacttaatccctgatttactttccagaccaatgaaacctttccagatcattaccaacactcactcatttctgttaatcctgatggtaaaaccatta |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||||| ||||||||||||||| |
|
|
T |
12364868 |
caaaacttaatccctgatttactttccagaccaatgaaacctgtccagatcattaccaacactcacacatttccgttaatcctcatggtaaaaccatta |
12364966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University