View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0092-INSERTION-8 (Length: 91)
Name: NF0092-INSERTION-8
Description: NF0092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0092-INSERTION-8 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 9e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 9e-36
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 50454071 - 50454154
Alignment:
Q |
8 |
gtaattagtcagaagaactatatgagagatgcccccaagtctttgtgtattaatggcatgtgctcttataaatagaactccaat |
91 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
50454071 |
gtaactagtcagaagaactatatgagagatgcccccaagtctttgtgtattaatggcatgtgctcctataaatagaactccaat |
50454154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University