View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0092_low_1 (Length: 578)
Name: NF0092_low_1
Description: NF0092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0092_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 8e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 8e-81
Query Start/End: Original strand, 286 - 442
Target Start/End: Complemental strand, 40749726 - 40749570
Alignment:
Q |
286 |
agaaacaaacaaaaaacaatcatttgaataaaattaacacattctagctagctcataattttccctttccctcttctgaaaaaatggggatgggaactag |
385 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40749726 |
agaaacaaacaaaaaacaatcatttgaataaaataaacacattctagctagctcataattttccctttccctcttctgaaaaaatggggatgggaactag |
40749627 |
T |
 |
Q |
386 |
cacctttgttactagatggatcaactttctcaccatggtaagtattccttttcttct |
442 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40749626 |
cacctttgttactagatggatcaactttctcaccatggtaagtattccttttcttct |
40749570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 143; E-Value: 8e-75
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 40750018 - 40749771
Alignment:
Q |
1 |
ttttcatcttaaaaaatgtgaagttttagtcactaaactac----tcgcctgnnnnnnnnngacagctttttgaatgttggtgttacttgtcac------ |
90 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||| || ||| |||||||||||| |||||||||||||||||||| |
|
|
T |
40750018 |
ttttcattttaaaaaatgtgaagttttagtcactaaactaccggatcaactg--aaaaaaagacagctttttggatgttggtgttacttgtcacggttat |
40749921 |
T |
 |
Q |
91 |
tgttatgttacggtctcatcggcatgggtgtgcataggatgctgtgtcgtagggtgttgggttttctttggcttacaaagttacattaaacacaccgtgt |
190 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40749920 |
ggttatgttacggtctcatcggcat-ggtgtgcataggatgctgtgtcgtagggtgttgggttttctttggcttacaaagttacattaaacacaccgtgt |
40749822 |
T |
 |
Q |
191 |
gcgtcaccatcatcataaatattcattcatatcatataatcaaacagtaac |
241 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
40749821 |
gcgtcaccatcatcataaatattcattcatatcataacatcaaacagtaac |
40749771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 809 times since January 2019
Visitors: 1284