View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0092_low_2 (Length: 476)
Name: NF0092_low_2
Description: NF0092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0092_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 94 - 387
Target Start/End: Complemental strand, 39809747 - 39809454
Alignment:
| Q |
94 |
atttccaggctagaagcatgcctctgaagttttttctgttgagtctcaatttgtattatctccccaatgccatctcccttttctccttctgacaactctt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39809747 |
atttccaggctagaagcatgcctctgaagttttttctgttgagtctcaatttgtattatctccccaatgccatctcccttttctccctctgacaactctt |
39809648 |
T |
 |
| Q |
194 |
cagacaaatcctctgttgcatcccttcgtccttgctctctttcccatcttctgtatgctaacctttgaagttcctctccttccacctacaaagtatgcct |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39809647 |
cagacaaatcctctgttgcatcccttcgtccttgctctctttcccatcttctgtatgctaacctttgaagttcctctccttccacctacaaagtatgcct |
39809548 |
T |
 |
| Q |
294 |
cattagtactctactagtttcaccaaacaaatcaagtgtttgagctgaaacactcaaaaaatgtagaagactaattaagagttcaaactttggt |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39809547 |
cattagtactctactagtttcaccaaacaaatcaagtgtttgagctgaaacactcaaaaaatgtagaagactaattaagagttcaaactttggt |
39809454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 172 - 283
Target Start/End: Complemental strand, 15796025 - 15795914
Alignment:
| Q |
172 |
ttttctccttctgacaactcttcagacaaatcctctgttgcatcccttcgtccttgctctctttcccatcttctgtatgctaacctttgaagttcctctc |
271 |
Q |
| |
|
||||||||||||||||| ||||| |||| || ||||| ||||| || |||||||| ||||| ||||||||||||| |||||| || || | |||||| | |
|
|
| T |
15796025 |
ttttctccttctgacaagtcttctgacatgtcttctgtagcatctctgcgtccttgttctctctcccatcttctgtttgctaatctctgtacttcctccc |
15795926 |
T |
 |
| Q |
272 |
cttccacctaca |
283 |
Q |
| |
|
||||| ||||| |
|
|
| T |
15795925 |
attccaactaca |
15795914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University