View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0093_low_2 (Length: 353)
Name: NF0093_low_2
Description: NF0093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0093_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 6e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 104 - 277
Target Start/End: Complemental strand, 56178224 - 56178052
Alignment:
| Q |
104 |
tggtagacctacataaacatataattctgattgtcttnnnnnnnnnnnctaggaaattgggatatacatgatgatggagtaaccagaaccaaacaatcat |
203 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56178224 |
tggtagacctacatatacatataaatctgattgtcttaaaaaaaata-ctaggaaattgggatatacatgatgatggagtaaccagaaccaaacaatcat |
56178126 |
T |
|
| Q |
204 |
ttacaagtcattcctaagaaaacttcttttacacaattacctattctttggtagaaaagaaatcagtacctatg |
277 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
56178125 |
ttacaagtcattcctatgaaaacttcttttacacaattacctattctttggaggaaaagaaatcagtacctatg |
56178052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1410 times since January 2019
Visitors: 1299