View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0093_low_3 (Length: 295)
Name: NF0093_low_3
Description: NF0093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0093_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 95 - 211
Target Start/End: Original strand, 35991460 - 35991576
Alignment:
| Q |
95 |
aagtcattgcccagtaatgcacctacacatgagtatcacaaatccttaacaagcttgattagttgattgattgatgatgaacaatttctgggtgcccata |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35991460 |
aagtcattgcccagtaatgcacctacacatgagtatcacaaatccttaacaagcttgattagttgattgattgatgatgaacaatttctgggtgtccata |
35991559 |
T |
|
| Q |
195 |
tgtgtatatataatatt |
211 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35991560 |
tgtgtatatataatatt |
35991576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 94 - 211
Target Start/End: Original strand, 35980705 - 35980817
Alignment:
| Q |
94 |
aaagtcattgcccagtaatgcacctacacatgagtatcacaaatccttaacaagcttgattagttgattgattgatgatgaacaatttctgggtgcccat |
193 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| | | |||||||||||||| | ||||||| |||||||||||||||||| |||| | | |
|
|
| T |
35980705 |
aaagtcattgcccagtaatgcacttacacatgagta-ctatactccttaacaagcttta----ttgattggttgatgatgaacaatttcacggtgttctt |
35980799 |
T |
|
| Q |
194 |
atgtgtatatataatatt |
211 |
Q |
| |
|
|||||||| |||| |||| |
|
|
| T |
35980800 |
atgtgtatttatagtatt |
35980817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1197 times since January 2019
Visitors: 1293