View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0093_low_4 (Length: 273)
Name: NF0093_low_4
Description: NF0093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0093_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 54 - 205
Target Start/End: Complemental strand, 45359650 - 45359504
Alignment:
| Q |
54 |
tgcacctgcatgtaaacattattattgccttctaatttagagcaatgttaaatttatttattggaaattgannnnnnnnnnnnnnnnnnnaatatttgtg |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
45359650 |
tgcacctgcatgtaaacattattattgccttctaatttagagcaatgttaaatttatttattggaaattga-----ttttttttttttttaatatttgag |
45359556 |
T |
|
| Q |
154 |
atgcttgttcttttgccttctgattactgtttgtattttcattgttctcatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45359555 |
atgcttgttcttttgccttctgattactgtttgtattttcattgttctcatt |
45359504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1233 times since January 2019
Visitors: 1293