View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0093_low_7 (Length: 229)
Name: NF0093_low_7
Description: NF0093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0093_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 181
Target Start/End: Original strand, 40982908 - 40983072
Alignment:
Q |
17 |
cacagagaccagatatatcaggctttgacaagagtttggtactcttgggcatgccatgcagtttcttttgtttcggaatttgtttcttcattacagctgc |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40982908 |
cacagagaccagatatatcaggctttgacaagagtttggtactcttgggcatgccatgcagtttcttttgtttcggaatttgtttcttcattacagctgc |
40983007 |
T |
 |
Q |
117 |
tcctgtcatttcatcgttcaaagaatgttttatggggtcaggtacgttagaaaacccaatttgtg |
181 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40983008 |
tcctgtcatttcatcggtcaaagaatgttttatggggtcaggtacgttagaaaacccaatttgtg |
40983072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1483 times since January 2019
Visitors: 1299