View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095-INSERTION-4 (Length: 135)
Name: NF0095-INSERTION-4
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0095-INSERTION-4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 2e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 11415035 - 11415159
Alignment:
| Q |
1 |
agtaaccgctactttccgtatnnnnnnnntcaaccactannnnnnnagtagggaaagaaaaaataatcaaccactactaacagtatctaagatattttaa |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11415035 |
agtaaccgctactttccgtataaaaaaaatcaaccactatttttttagtagggaaagaaaaaataatcaaccactactaacagtatctaagatattttaa |
11415134 |
T |
 |
| Q |
101 |
tctatatgataaattctattatatt |
125 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
11415135 |
tctatatgataagttctattatatt |
11415159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University