View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095-INSERTION-4 (Length: 135)

Name: NF0095-INSERTION-4
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095-INSERTION-4
NF0095-INSERTION-4
[»] chr4 (1 HSPs)
chr4 (1-125)||(11415035-11415159)


Alignment Details
Target: chr4 (Bit Score: 76; Significance: 2e-35; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 11415035 - 11415159
Alignment:
1 agtaaccgctactttccgtatnnnnnnnntcaaccactannnnnnnagtagggaaagaaaaaataatcaaccactactaacagtatctaagatattttaa 100  Q
    |||||||||||||||||||||        ||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11415035 agtaaccgctactttccgtataaaaaaaatcaaccactatttttttagtagggaaagaaaaaataatcaaccactactaacagtatctaagatattttaa 11415134  T
101 tctatatgataaattctattatatt 125  Q
    |||||||||||| ||||||||||||    
11415135 tctatatgataagttctattatatt 11415159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 781 times since January 2019
Visitors: 1284