View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0095-INSERTION-9 (Length: 695)

Name: NF0095-INSERTION-9
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0095-INSERTION-9
NF0095-INSERTION-9
[»] chr7 (16 HSPs)
chr7 (359-554)||(12628031-12628226)
chr7 (360-466)||(12629377-12629484)
chr7 (361-415)||(5769306-5769360)
chr7 (640-686)||(12628312-12628358)
chr7 (361-417)||(47578583-47578639)
chr7 (360-415)||(21261979-21262034)
chr7 (361-418)||(19628179-19628235)
chr7 (360-415)||(21263319-21263374)
chr7 (427-510)||(23455424-23455507)
chr7 (361-415)||(5737177-5737231)
chr7 (360-413)||(7848005-7848058)
chr7 (360-413)||(23456681-23456734)
chr7 (356-414)||(23455351-23455407)
chr7 (360-415)||(23525580-23525635)
chr7 (360-418)||(19626671-19626729)
chr7 (427-467)||(23456625-23456665)
[»] chr8 (12 HSPs)
chr8 (78-204)||(24787515-24787641)
chr8 (360-509)||(14100994-14101144)
chr8 (309-358)||(24787311-24787360)
chr8 (356-416)||(9755679-9755739)
chr8 (357-415)||(3923608-3923666)
chr8 (356-413)||(40462265-40462322)
chr8 (359-413)||(14099743-14099796)
chr8 (360-415)||(3917795-3917849)
chr8 (357-413)||(38980160-38980215)
chr8 (357-413)||(39011257-39011312)
chr8 (360-413)||(42480897-42480949)
chr8 (378-418)||(40463603-40463643)
[»] chr4 (31 HSPs)
chr4 (28-119)||(27068537-27068628)
chr4 (361-416)||(5169313-5169368)
chr4 (356-413)||(20673560-20673617)
chr4 (360-416)||(16314200-16314256)
chr4 (360-468)||(51568808-51568916)
chr4 (356-415)||(23504890-23504949)
chr4 (361-415)||(23506383-23506437)
chr4 (355-414)||(12862715-12862774)
chr4 (361-415)||(17288631-17288685)
chr4 (359-417)||(24685022-24685080)
chr4 (360-415)||(1997058-1997113)
chr4 (359-418)||(39661314-39661373)
chr4 (360-418)||(20674809-20674867)
chr4 (359-416)||(16312645-16312702)
chr4 (359-415)||(1995866-1995922)
chr4 (361-417)||(5170383-5170439)
chr4 (364-416)||(47861936-47861987)
chr4 (427-509)||(6210672-6210754)
chr4 (359-405)||(17288766-17288812)
chr4 (359-413)||(43742024-43742078)
chr4 (362-416)||(56083355-56083408)
chr4 (361-405)||(2753075-2753119)
chr4 (427-467)||(12861478-12861518)
chr4 (360-415)||(2751517-2751572)
chr4 (360-415)||(44353875-44353930)
chr4 (362-412)||(6657482-6657532)
chr4 (360-414)||(6866692-6866746)
chr4 (359-413)||(12861410-12861463)
chr4 (361-414)||(6872603-6872656)
chr4 (427-467)||(6657546-6657586)
chr4 (427-467)||(23506330-23506370)
[»] chr3 (14 HSPs)
chr3 (360-418)||(37086738-37086796)
chr3 (360-416)||(36438772-36438828)
chr3 (359-418)||(15439676-15439735)
chr3 (359-418)||(37085411-37085470)
chr3 (360-418)||(34799864-34799922)
chr3 (360-418)||(42278452-42278510)
chr3 (349-416)||(36437202-36437269)
chr3 (360-415)||(30034613-30034668)
chr3 (360-414)||(15438469-15438523)
chr3 (356-413)||(48537847-48537902)
chr3 (373-418)||(34801388-34801433)
chr3 (360-416)||(11150270-11150326)
chr3 (360-416)||(39606636-39606692)
chr3 (362-412)||(11151596-11151646)
[»] chr1 (16 HSPs)
chr1 (359-418)||(21747941-21748000)
chr1 (360-418)||(42098727-42098785)
chr1 (361-418)||(42097326-42097383)
chr1 (360-415)||(17240716-17240771)
chr1 (359-509)||(21749193-21749343)
chr1 (360-418)||(43403294-43403352)
chr1 (360-413)||(13971004-13971057)
chr1 (359-415)||(17242103-17242159)
chr1 (359-413)||(43402261-43402314)
chr1 (361-413)||(9008761-9008812)
chr1 (361-413)||(35713697-35713749)
chr1 (356-416)||(51676335-51676394)
chr1 (360-417)||(37183344-37183401)
chr1 (359-412)||(48030240-48030292)
chr1 (21-85)||(8633588-8633652)
chr1 (360-412)||(24302935-24302985)
[»] scaffold0071 (2 HSPs)
scaffold0071 (359-418)||(22456-22515)
scaffold0071 (360-414)||(23668-23722)
[»] chr6 (12 HSPs)
chr6 (361-417)||(25482148-25482204)
chr6 (358-414)||(32146093-32146149)
chr6 (355-417)||(12603931-12603992)
chr6 (363-418)||(26545866-26545920)
chr6 (361-415)||(21383820-21383874)
chr6 (355-417)||(25483398-25483459)
chr6 (359-467)||(35223130-35223239)
chr6 (360-416)||(5858897-5858953)
chr6 (358-413)||(9307142-9307197)
chr6 (360-415)||(21382481-21382536)
chr6 (360-415)||(9305620-9305675)
chr6 (361-410)||(7538261-7538310)
[»] scaffold0262 (2 HSPs)
scaffold0262 (355-413)||(4382-4440)
scaffold0262 (360-467)||(2759-2865)
[»] scaffold0049 (4 HSPs)
scaffold0049 (361-415)||(386-440)
scaffold0049 (361-413)||(3419-3471)
scaffold0049 (359-409)||(1130-1180)
scaffold0049 (360-413)||(3925-3977)
[»] scaffold0061 (1 HSPs)
scaffold0061 (359-416)||(11253-11310)
[»] chr2 (1 HSPs)
chr2 (356-417)||(25650002-25650063)
[»] chr5 (3 HSPs)
chr5 (360-415)||(29875946-29876000)
chr5 (361-412)||(32953094-32953145)
chr5 (359-413)||(27490097-27490151)
[»] scaffold0484 (2 HSPs)
scaffold0484 (359-413)||(11534-11587)
scaffold0484 (360-413)||(12800-12852)
[»] scaffold0408 (1 HSPs)
scaffold0408 (359-412)||(10085-10136)


Alignment Details
Target: chr7 (Bit Score: 133; Significance: 8e-69; HSPs: 16)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 133; E-Value: 8e-69
Query Start/End: Original strand, 359 - 554
Target Start/End: Original strand, 12628031 - 12628226
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatgnnnnnnnn-cttggagattcccccttgtcattattagatt 457  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||         ||||||||| |||||||| ||||||||||||    
12628031 tagggttaataggcttttacccccctgccatttgcgggtcttttggtttacccccctatggaaaaaaaacttggagatccccccttgccattattagatt 12628130  T
458 ctttggttttagcccccaaacacatatgattgtataatttggctgatgtggcgtgccgattgtacattgattaacaaggtggcactcgtgacttgac 554  Q
    | |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||    
12628131 cgttggttttggcccccaaacacatatgattgtataatttggctgatgtggcgtgctgattgtacattgattaacaaggtggcactc-tgacttgac 12628226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 360 - 466
Target Start/End: Complemental strand, 12629484 - 12629377
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctat-gnnnnnnnncttggagattcccccttgtcattattagattc 458  Q
    |||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |        |||| ||||||||||||| |||||||||||||    
12629484 agggttaataggcttttacccccctgccatttacgggtcttttggtttacccccctatcgaaaaaaaacttgaagattcccccttgccattattagattc 12629385  T
459 tttggttt 466  Q
    ||||||||    
12629384 tttggttt 12629377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 361 - 415
Target Start/End: Complemental strand, 5769360 - 5769306
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||||||||||||||||||||||||||| | |||||||||| |||||||||    
5769360 gggttaataggcttttacccccctgccatttgggggtcttttggtatacccccct 5769306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 640 - 686
Target Start/End: Original strand, 12628312 - 12628358
Alignment:
640 caccatatcttcaaaattcagatctaaactcccatcctctctctctc 686  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||    
12628312 caccatatcttcaaaatccagatctaaactcccatcctctctctctc 12628358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 361 - 417
Target Start/End: Complemental strand, 47578639 - 47578583
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctat 417  Q
    |||||||||||||||||||||||||||||||| | | |||||||| |||||||||||    
47578639 gggttaataggcttttacccccctgccatttgggagacttttggtatacccccctat 47578583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 360 - 415
Target Start/End: Original strand, 21261979 - 21262034
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    ||||||||||||||||||||||||||||||||  | |||||||||| |||||||||    
21261979 agggttaataggcttttacccccctgccatttaggggtcttttggtatacccccct 21262034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 361 - 418
Target Start/End: Complemental strand, 19628235 - 19628179
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    ||||||||||| |||||||||| ||||||||| | |||||||||||||||||||||||    
19628235 gggttaataggtttttaccccc-tgccatttgggagtcttttggtttacccccctatg 19628179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 360 - 415
Target Start/End: Complemental strand, 21263374 - 21263319
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||||||||||| ||||||||||||| || | |||||||||| |||||||||    
21263374 agggttaataggctttcacccccctgccatatgggggtcttttggtatacccccct 21263319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 427 - 510
Target Start/End: Original strand, 23455424 - 23455507
Alignment:
427 cttggagattcccccttgtcattattagattctttggttttagcccccaaacacatatgattgtataatttggctgatgtggcg 510  Q
    ||||||||||||||||| |||||   ||||||||||||||| | |||||| ||||| ||| ||| ||  |||||||||||||||    
23455424 cttggagattcccccttatcatttaaagattctttggttttggaccccaagcacatctgactgtgtatgttggctgatgtggcg 23455507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 361 - 415
Target Start/End: Original strand, 5737177 - 5737231
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||||||||||||||||||||||||||| | |  ||||||| |||||||||    
5737177 gggttaataggcttttacccccctgccatttgggggctttttggtatacccccct 5737231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 413
Target Start/End: Original strand, 7848005 - 7848058
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    ||||||||| |||||||||||||||||||| || | |||||||||| |||||||    
7848005 agggttaatgggcttttacccccctgccatatgagggtcttttggtataccccc 7848058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 360 - 413
Target Start/End: Complemental strand, 23456734 - 23456681
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    |||||||||||| |||||| |||||||||| || |||||||||||| |||||||    
23456734 agggttaataggtttttactcccctgccatatgagcgtcttttggtataccccc 23456681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 356 - 414
Target Start/End: Original strand, 23455351 - 23455407
Alignment:
356 aaatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccc 414  Q
    ||||||||||||||||||||||  |||||||||| || |||| ||||||| ||||||||    
23455351 aaatagggttaataggctttta--cccctgccatatgagcgtattttggtatacccccc 23455407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 360 - 415
Target Start/End: Original strand, 23525580 - 23525635
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||||||||||||||||| |||||||||| | |  ||||||| |||||||||    
23525580 agggttaataggcttttaccccgctgccatttgggggatttttggtatacccccct 23525635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 360 - 418
Target Start/End: Original strand, 19626671 - 19626729
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    ||||||||||||| ||| |||| |||||||||| | ||  |||||||||||||||||||    
19626671 agggttaataggcattttcccctctgccatttgggagttgtttggtttacccccctatg 19626729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 427 - 467
Target Start/End: Complemental strand, 23456665 - 23456625
Alignment:
427 cttggagattcccccttgtcattattagattctttggtttt 467  Q
    |||||||||||||||||||||||   |||||||||||||||    
23456665 cttggagattcccccttgtcatttaaagattctttggtttt 23456625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 127; Significance: 3e-65; HSPs: 12)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 78 - 204
Target Start/End: Complemental strand, 24787641 - 24787515
Alignment:
78 ctgctaatatcatcaatagaaggagaaaatttgtttgttcaaccatataaacattcgatgagaaggtgatgttttatgaagtttctttctctttaactat 177  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24787641 ctgctaatatcatcaatagaaggagaaaatttgtttgttcaaccatataaacattcgatgagaaggtgatgttttatgaagtttctttctctttaactat 24787542  T
178 ttctctatgtactcagtttgttaatcc 204  Q
    |||||||||||||||||||||||||||    
24787541 ttctctatgtactcagtttgttaatcc 24787515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 360 - 509
Target Start/End: Complemental strand, 14101144 - 14100994
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct-atgnnnnnnnncttggagattcccccttgtcattattagattc 458  Q
    |||||||||||||||||||||||||||||| || |||||||||||||||||||||| |          |||||||||||||||||| |||||  ||||||    
14101144 agggttaataggcttttacccccctgccatatgagcgtcttttggtttacccccctaacaaaaaaaaacttggagattcccccttgccattagaagattc 14101045  T
459 tttggttttagcccccaaacacatatgattgtataatttggctgatgtggc 509  Q
    |||| |||| | |||||||||||| ||| ||| || ||||| |||| ||||    
14101044 tttgattttggaccccaaacacatctgactgtgtattttggatgatttggc 14100994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 309 - 358
Target Start/End: Complemental strand, 24787360 - 24787311
Alignment:
309 gataaaatatcattcgaattctgtgaagaacaagtctggctctttctaaa 358  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||    
24787360 gataaaatatcattcgaattatgtgaagaacaagtctggctctttctaaa 24787311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 356 - 416
Target Start/End: Original strand, 9755679 - 9755739
Alignment:
356 aaatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccccta 416  Q
    ||||||||||||||| ||||||||||||||||||||| | |||||||||| ||||||||||    
9755679 aaatagggttaatagacttttacccccctgccatttgggggtcttttggtataccccccta 9755739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 357 - 415
Target Start/End: Complemental strand, 3923666 - 3923608
Alignment:
357 aatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||||||||||||||||||||||| ||||||| ||| | ||||||||||||||||    
3923666 aatagggttaataggcttttacccccctaccatttgggcgacatttggtttacccccct 3923608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 356 - 413
Target Start/End: Original strand, 40462265 - 40462322
Alignment:
356 aaatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    |||||||||||||||||||||||||||||||||| || | | ||||||||||||||||    
40462265 aaatagggttaataggcttttacccccctgccatatgggtgacttttggtttaccccc 40462322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 359 - 413
Target Start/End: Original strand, 14099743 - 14099796
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    ||||||||||||||||||||||| |||||||||| | ||||||||||||||||||    
14099743 tagggttaataggcttttacccc-ctgccatttgggggtcttttggtttaccccc 14099796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 360 - 415
Target Start/End: Original strand, 3917795 - 3917849
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||||||||||||||||| |||||||||| ||| | ||||||||||||||||    
3917795 agggttaataggcttttacccc-ctgccatttgggcgacatttggtttacccccct 3917849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 357 - 413
Target Start/End: Complemental strand, 38980215 - 38980160
Alignment:
357 aatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    ||||||||||||||| |||||||||| || |||||| | ||||||||||||||||||    
38980215 aatagggttaataggtttttaccccc-tgtcatttgggagtcttttggtttaccccc 38980160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 357 - 413
Target Start/End: Complemental strand, 39011312 - 39011257
Alignment:
357 aatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    ||||||||||||||| |||||||||| || |||||| | ||||||||||||||||||    
39011312 aatagggttaataggtttttaccccc-tgtcatttgggagtcttttggtttaccccc 39011257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 360 - 413
Target Start/End: Original strand, 42480897 - 42480949
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    |||||||||||||||||| |||||||||||||  | || |||||||||||||||    
42480897 agggttaataggctttta-ccccctgccatttaggggttttttggtttaccccc 42480949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 378 - 418
Target Start/End: Complemental strand, 40463643 - 40463603
Alignment:
378 cccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    ||||||||||||||| | |||||||||||||||| ||||||    
40463643 cccccctgccatttgggggtcttttggtttaccctcctatg 40463603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 68; Significance: 5e-30; HSPs: 31)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 28 - 119
Target Start/End: Original strand, 27068537 - 27068628
Alignment:
28 gaagaggatttaagttgtggtaatgattatcaaaacagagcactactcatctgctaatatcatcaatagaaggagaaaatttgtttgttcaa 119  Q
    |||||||||||||||||| |||| |||||| |||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||    
27068537 gaagaggatttaagttgtagtaaggattatgaaaacagagcacaactcatctgctaatatcatcagtagaaagagaaaatttgtttgttcaa 27068628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 361 - 416
Target Start/End: Original strand, 5169313 - 5169368
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccccta 416  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
5169313 gggttaataggcttttacccccctgccatttgggcgtcttttggtttaccccccta 5169368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 356 - 413
Target Start/End: Original strand, 20673560 - 20673617
Alignment:
356 aaatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||    
20673560 aaatagggttaataggcttttacccccctgccatttgggtgtcttttggtttaccccc 20673617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 360 - 416
Target Start/End: Complemental strand, 16314256 - 16314200
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccccta 416  Q
    ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||    
16314256 agggttaataggcttttacccccctgccatttgggggtcttttggtttaccccccta 16314200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 360 - 468
Target Start/End: Original strand, 51568808 - 51568916
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatgnnnnnnnncttggagattcccccttgtcattattagattct 459  Q
    ||||||||||||||||||||||||||||||||| ||| |||||||||||  ||||||||        ||||||||| |||||| | |||||  |||||||    
51568808 agggttaataggcttttacccccctgccatttgagcgacttttggtttatgcccctatgaaaaaaaacttggagatcccccctcgacattagaagattct 51568907  T
460 ttggtttta 468  Q
    |||||||||    
51568908 ttggtttta 51568916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 356 - 415
Target Start/End: Original strand, 23504890 - 23504949
Alignment:
356 aaatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    ||||||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||    
23504890 aaatagggttaataggcttttacccccctgccatttgggggtctttttgtttacccccct 23504949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 361 - 415
Target Start/End: Complemental strand, 23506437 - 23506383
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||||||||||||||||||||||||||| | ||||||||||||||||||||    
23506437 gggttaataggcttttacccccctgccatttgggggtcttttggtttacccccct 23506383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 355 - 414
Target Start/End: Complemental strand, 12862774 - 12862715
Alignment:
355 taaatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccc 414  Q
    |||||||||||||||||| ||||||||||||||||||| | || ||||||||||||||||    
12862774 taaatagggttaataggcgtttacccccctgccatttgagggtattttggtttacccccc 12862715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 361 - 415
Target Start/End: Original strand, 17288631 - 17288685
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||||||||||||||||||||||||||| | | ||||||||||||||||||    
17288631 gggttaataggcttttacccccctgccatttgggggacttttggtttacccccct 17288685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 359 - 417
Target Start/End: Original strand, 24685022 - 24685080
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctat 417  Q
    ||||||||||||||||||||||||||||||| || |||| ||||||| |||||||||||    
24685022 tagggttaataggcttttacccccctgccatatgggcgtattttggtatacccccctat 24685080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 360 - 415
Target Start/End: Complemental strand, 1997113 - 1997058
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    ||||||||||||||||||||||||||||||||  | |||||||||| |||||||||    
1997113 agggttaataggcttttacccccctgccatttaggggtcttttggtatacccccct 1997058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 359 - 418
Target Start/End: Complemental strand, 39661373 - 39661314
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    ||||||||||||| ||||| |||||||||||||| | |||||||||||||||||| ||||    
39661373 tagggttaataggtttttaaccccctgccatttgggggtcttttggtttacccccatatg 39661314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 360 - 418
Target Start/End: Complemental strand, 20674867 - 20674809
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    ||||||||||||||||||||||||||||||||| | |  ||||||||||||| ||||||    
20674867 agggttaataggcttttacccccctgccatttgggagatttttggtttaccctcctatg 20674809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 416
Target Start/End: Original strand, 16312645 - 16312702
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccccta 416  Q
    |||||||||||| || |||||||||||||||||| | || ||||||||||||||||||    
16312645 tagggttaatagcctcttacccccctgccatttgggggttttttggtttaccccccta 16312702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 359 - 415
Target Start/End: Original strand, 1995866 - 1995922
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    ||||||||||||||||| ||||||||||||| || | |||||||||| |||||||||    
1995866 tagggttaataggctttcacccccctgccatatgggggtcttttggtatacccccct 1995922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 361 - 417
Target Start/End: Complemental strand, 5170439 - 5170383
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctat 417  Q
    |||||||||||||||||||||||||||||||  | || ||||||| |||||||||||    
5170439 gggttaataggcttttacccccctgccattttggagttttttggtatacccccctat 5170383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 364 - 416
Target Start/End: Original strand, 47861936 - 47861987
Alignment:
364 ttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccccta 416  Q
    |||||||||||||||||| |||||||||| | |||||||||||||||||||||    
47861936 ttaataggcttttacccc-ctgccatttgggggtcttttggtttaccccccta 47861987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 427 - 509
Target Start/End: Original strand, 6210672 - 6210754
Alignment:
427 cttggagattcccccttgtcattattagattctttggttttagcccccaaacacatatgattgtataatttggctgatgtggc 509  Q
    |||||||||||||||||| |||||  |||||||||| |||| | ||||||| |||| ||||||| || ||||| |||| ||||    
6210672 cttggagattcccccttgccattagaagattctttgattttggaccccaaagacatctgattgtgtattttggatgatttggc 6210754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 359 - 405
Target Start/End: Complemental strand, 17288812 - 17288766
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggt 405  Q
    |||||||||||||||||||||||||||||||||| | | ||||||||    
17288812 tagggttaataggcttttacccccctgccatttgggggacttttggt 17288766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 359 - 413
Target Start/End: Complemental strand, 43742078 - 43742024
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    |||||||||||| ||||||| ||||||| ||||| | ||||||||||||||||||    
43742078 tagggttaatagacttttacacccctgctatttgggggtcttttggtttaccccc 43742024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 362 - 416
Target Start/End: Original strand, 56083355 - 56083408
Alignment:
362 ggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccccta 416  Q
    |||||||||||||||||||| |||||||||| | |||||||||| ||||||||||    
56083355 ggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccccta 56083408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 361 - 405
Target Start/End: Complemental strand, 2753119 - 2753075
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggt 405  Q
    |||||||||||||||||||||||||||||||| | | ||||||||    
2753119 gggttaataggcttttacccccctgccatttgggggacttttggt 2753075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 427 - 467
Target Start/End: Original strand, 12861478 - 12861518
Alignment:
427 cttggagattcccccttgtcattattagattctttggtttt 467  Q
    ||||||||||||||||||||||||  |||||||||||||||    
12861478 cttggagattcccccttgtcattaggagattctttggtttt 12861518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 360 - 415
Target Start/End: Original strand, 2751517 - 2751572
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||||| ||||||| |||||||||||||| | | |||||||| |||||||||    
2751517 agggttaataagcttttatccccctgccatttgggggacttttggtatacccccct 2751572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 360 - 415
Target Start/End: Original strand, 44353875 - 44353930
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||| || ||||||||||||||||||||| | | |||||||| |||||||||    
44353875 agggttaacagacttttacccccctgccatttgggggacttttggtatacccccct 44353930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 362 - 412
Target Start/End: Original strand, 6657482 - 6657532
Alignment:
362 ggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccc 412  Q
    ||||||||||||||||| ||||||||||||| | || ||||| ||||||||    
6657482 ggttaataggcttttactcccctgccatttgtgggtgttttgctttacccc 6657532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 360 - 414
Target Start/End: Original strand, 6866692 - 6866746
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccc 414  Q
    ||||||||||||  ||||||||||||||||||| |   |||||||||||||||||    
6866692 agggttaataggggtttacccccctgccatttggggtacttttggtttacccccc 6866746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 359 - 413
Target Start/End: Original strand, 12861410 - 12861463
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    ||||||||||||||||||| |||||||| ||||| | || |||||||||||||||    
12861410 tagggttaataggctttta-ccccctgctatttgggggtgttttggtttaccccc 12861463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 361 - 414
Target Start/End: Complemental strand, 6872656 - 6872603
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccc 414  Q
    |||||||||||  ||||||||||||||||||| |   |||||||||||||||||    
6872656 gggttaataggggtttacccccctgccatttggggtacttttggtttacccccc 6872603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 427 - 467
Target Start/End: Original strand, 6657546 - 6657586
Alignment:
427 cttggagattcccccttgtcattattagattctttggtttt 467  Q
    |||| |||||||||||||||||||  |||||||||||||||    
6657546 cttgtagattcccccttgtcattaggagattctttggtttt 6657586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 427 - 467
Target Start/End: Complemental strand, 23506370 - 23506330
Alignment:
427 cttggagattcccccttgtcattattagattctttggtttt 467  Q
    ||||||||||||||||||| |||  ||||||||||||||||    
23506370 cttggagattcccccttgtaatttatagattctttggtttt 23506330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 55; Significance: 3e-22; HSPs: 14)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 360 - 418
Target Start/End: Complemental strand, 37086796 - 37086738
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
37086796 agggttaataggcttttacccccctgccatttgagcgtcttttggtttacccccctatg 37086738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 360 - 416
Target Start/End: Complemental strand, 36438828 - 36438772
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccccta 416  Q
    ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||    
36438828 agggttaataggcttttacccccctgccatttgggggtcttttggtttaccccccta 36438772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 359 - 418
Target Start/End: Complemental strand, 15439735 - 15439676
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    ||||||||||||||||||||||||| |||||||| | |||||||||||||||||||||||    
15439735 tagggttaataggcttttacccccccgccatttgggggtcttttggtttacccccctatg 15439676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 359 - 418
Target Start/End: Original strand, 37085411 - 37085470
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    ||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||    
37085411 tagggttaataggtttttatccccctgccatttgggcgtcttttggtttacccccctatg 37085470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 360 - 418
Target Start/End: Original strand, 34799864 - 34799922
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    ||||||||||| ||||||||||||||||||||| | |||||||||||||||||||||||    
34799864 agggttaatagacttttacccccctgccatttgggggtcttttggtttacccccctatg 34799922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 360 - 418
Target Start/End: Complemental strand, 42278510 - 42278452
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    ||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||    
42278510 agggttaataggcttttacccccctaccatttgggggtcttttggtttacccccctatg 42278452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 349 - 416
Target Start/End: Original strand, 36437202 - 36437269
Alignment:
349 tctttctaaatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccccta 416  Q
    ||||| ||| |||||||||||| ||||||||||||||||||||| | || ||||||||||||||||||    
36437202 tctttttaattagggttaatagccttttacccccctgccatttgggggttttttggtttaccccccta 36437269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 360 - 415
Target Start/End: Original strand, 30034613 - 30034668
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||||||| |||||||||||||||||||| ||| | ||||||||||||||||    
30034613 agggttaatagggttttacccccctgccatttgggcgacatttggtttacccccct 30034668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 360 - 414
Target Start/End: Original strand, 15438469 - 15438523
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccc 414  Q
    ||||||||||||||||||||||||||||||||| | || ||||||| ||||||||    
15438469 agggttaataggcttttacccccctgccatttgagggttttttggtatacccccc 15438523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 356 - 413
Target Start/End: Original strand, 48537847 - 48537902
Alignment:
356 aaatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    ||||||||||||||||||||||  ||||||||||||| | ||||||||||||||||||    
48537847 aaatagggttaataggctttta--cccctgccatttgggggtcttttggtttaccccc 48537902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 373 - 418
Target Start/End: Complemental strand, 34801433 - 34801388
Alignment:
373 ttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    |||||||||||||||||||| | |||||||||||||||||||||||    
34801433 ttttacccccctgccatttgggggtcttttggtttacccccctatg 34801388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 416
Target Start/End: Original strand, 11150270 - 11150326
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccccta 416  Q
    |||||||||||||||||||||||| |||||||| | |  ||||||||||||||||||    
11150270 agggttaataggcttttaccccccagccatttgggggatttttggtttaccccccta 11150326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 416
Target Start/End: Complemental strand, 39606692 - 39606636
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccccta 416  Q
    |||||||| ||||||||||||||||||||||||   ||||||||||||| |||||||    
39606692 agggttaaaaggcttttacccccctgccatttggaagtcttttggtttatcccccta 39606636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 362 - 412
Target Start/End: Complemental strand, 11151646 - 11151596
Alignment:
362 ggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccc 412  Q
    ||||||||||||||||||||||| ||||||| | | |||||||||||||||    
11151646 ggttaataggcttttacccccctaccatttgggggacttttggtttacccc 11151596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 52; Significance: 2e-20; HSPs: 16)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 359 - 418
Target Start/End: Original strand, 21747941 - 21748000
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    |||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||    
21747941 tagggttaataggcttttacccccctgccatttgggggtcttttggtttacccccctatg 21748000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 360 - 418
Target Start/End: Complemental strand, 42098785 - 42098727
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    ||||||||||||||||||||||||||||||||| | ||||||||||||| |||||||||    
42098785 agggttaataggcttttacccccctgccatttgggggtcttttggtttatccccctatg 42098727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 361 - 418
Target Start/End: Original strand, 42097326 - 42097383
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    ||||||||||| |||||||||||||||||||| | |||||||||||||||||||||||    
42097326 gggttaataggtttttacccccctgccatttgggggtcttttggtttacccccctatg 42097383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 360 - 415
Target Start/End: Original strand, 17240716 - 17240771
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    ||||||||||||||||||||||||||||||||| | |||||||||| |||||||||    
17240716 agggttaataggcttttacccccctgccatttgggggtcttttggtatacccccct 17240771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 359 - 509
Target Start/End: Complemental strand, 21749343 - 21749193
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct-atgnnnnnnnncttggagattcccccttgtcattattagatt 457  Q
    |||||||||||||||||||||||| | |||| || |||||||||||||||||||||| |          |||||||||||||||||| |||||  |||||    
21749343 tagggttaataggcttttaccccc-taccatatgtgcgtcttttggtttacccccctaacaaaaaaaaacttggagattcccccttgccattagaagatt 21749245  T
458 ctttggttttagcccccaaacacatatgattgtataatttggctgatgtggc 509  Q
    ||||| |||| | |||||||||||| ||| ||| || ||||| |||| ||||    
21749244 ctttgattttggaccccaaacacatctgactgtgtattttggatgatttggc 21749193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 360 - 418
Target Start/End: Complemental strand, 43403352 - 43403294
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    |||||||||||||||||| ||||||| |||||| | |||||||||||||||||||||||    
43403352 agggttaataggcttttatccccctgtcatttgggggtcttttggtttacccccctatg 43403294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 360 - 413
Target Start/End: Complemental strand, 13971057 - 13971004
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    |||||||||||| |||||| ||||||||||||| | ||||||||||||||||||    
13971057 agggttaataggtttttactcccctgccatttgggagtcttttggtttaccccc 13971004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 359 - 415
Target Start/End: Complemental strand, 17242159 - 17242103
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||||||||||||||||||||||||||||| | |  ||||||| |||||||||    
17242159 tagggttaataggcttttacccccctgccatttgggggctttttggtatacccccct 17242103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 359 - 413
Target Start/End: Original strand, 43402261 - 43402314
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    |||| |||||||||||||||||| |||||||||| | ||||||||||||||||||    
43402261 taggattaataggcttttacccc-ctgccatttgggggtcttttggtttaccccc 43402314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 361 - 413
Target Start/End: Original strand, 9008761 - 9008812
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    ||||||||||||||||||||| |||||||||| | |||||||||| |||||||    
9008761 gggttaataggcttttacccc-ctgccatttgggggtcttttggtataccccc 9008812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 361 - 413
Target Start/End: Complemental strand, 35713749 - 35713697
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    |||||||| |||||||||||||||||||| || | |||||||||| |||||||    
35713749 gggttaatgggcttttacccccctgccatatgggggtcttttggtataccccc 35713697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 356 - 416
Target Start/End: Complemental strand, 51676394 - 51676335
Alignment:
356 aaatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccccta 416  Q
    ||||||||||||||| ||||||| ||||||| ||||| | |||||||||| ||||||||||    
51676394 aaatagggttaatagacttttac-cccctgctatttgggggtcttttggtataccccccta 51676335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 360 - 417
Target Start/End: Complemental strand, 37183401 - 37183344
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctat 417  Q
    |||||||||||||||||||||| ||| ||| |   ||||||||||||||||| |||||    
37183401 agggttaataggcttttacccctctgtcatatagacgtcttttggtttaccctcctat 37183344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 359 - 412
Target Start/End: Complemental strand, 48030292 - 48030240
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccc 412  Q
    |||||||||||||||||||| ||||||||||||| | |||||||| | ||||||    
48030292 tagggttaataggcttttac-cccctgccatttgggggtcttttgatatacccc 48030240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 21 - 85
Target Start/End: Original strand, 8633588 - 8633652
Alignment:
21 acaggtcgaagaggatttaagttgtggtaatgattatcaaaacagagcactactcatctgctaat 85  Q
    |||||| ||||| |||||||||||| || || ||||| ||||||| |||| |||| |||||||||    
8633588 acaggttgaagaagatttaagttgttgtgattattatgaaaacagtgcaccactcttctgctaat 8633652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 360 - 412
Target Start/End: Original strand, 24302935 - 24302985
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccc 412  Q
    |||||||||||| ||||| |||||||||||||| | |||||||||||||||||    
24302935 agggttaataggatttta-ccccctgccatttg-gggtcttttggtttacccc 24302985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0071 (Bit Score: 48; Significance: 4e-18; HSPs: 2)
Name: scaffold0071
Description:

Target: scaffold0071; HSP #1
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 359 - 418
Target Start/End: Original strand, 22456 - 22515
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    ||||||||||||||||||||||||| |||||||| | |||||||||||||||||||||||    
22456 tagggttaataggcttttacccccccgccatttgggggtcttttggtttacccccctatg 22515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0071; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 360 - 414
Target Start/End: Complemental strand, 23722 - 23668
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccc 414  Q
    ||||||||||||||||||||||||||||||||| | || ||||||| ||||||||    
23722 agggttaataggcttttacccccctgccatttgagggttttttggtatacccccc 23668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 45; Significance: 3e-16; HSPs: 12)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 361 - 417
Target Start/End: Original strand, 25482148 - 25482204
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctat 417  Q
    |||||||||||||||||||||||||||||||  | ||||||||||||||||||||||    
25482148 gggttaataggcttttacccccctgccatttaggagtcttttggtttacccccctat 25482204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 358 - 414
Target Start/End: Complemental strand, 32146149 - 32146093
Alignment:
358 atagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccc 414  Q
    |||||||||||||||||||| |||||||||||||| | |||||||||||||||||||    
32146149 atagggttaataggcttttatccccctgccatttgggggtcttttggtttacccccc 32146093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 355 - 417
Target Start/End: Original strand, 12603931 - 12603992
Alignment:
355 taaatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctat 417  Q
    |||| |||||||||||||||||||||| |||||||||| | ||||||||||||||||||||||    
12603931 taaaaagggttaataggcttttacccc-ctgccatttgggagtcttttggtttacccccctat 12603992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 363 - 418
Target Start/End: Complemental strand, 26545920 - 26545866
Alignment:
363 gttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatg 418  Q
    |||||||||||||||||||| ||||||||| | |||||||||||||||||||||||    
26545920 gttaataggcttttaccccc-tgccatttgagggtcttttggtttacccccctatg 26545866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 361 - 415
Target Start/End: Complemental strand, 21383874 - 21383820
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||||||||||||||||||||||||||  | |||||||||| |||||||||    
21383874 gggttaataggcttttacccccctgccatttaggggtcttttggtatacccccct 21383820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 355 - 417
Target Start/End: Complemental strand, 25483459 - 25483398
Alignment:
355 taaatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctat 417  Q
    |||| ||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||    
25483459 taaaaagggttaataggcttttaccccc-tgccatttgggagtcttttggattacccccctat 25483398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 467
Target Start/End: Original strand, 35223130 - 35223239
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatgnnnnnnnn-cttggagattcccccttgtcattattagatt 457  Q
    |||||||||||| |||||||||||||||||||||   || ||||||||||||||||||           ||||||||||||||||||||||||  |||||    
35223130 tagggttaatagacttttacccccctgccatttggcggtgttttggtttacccccctaacaaaaaaaaacttggagattcccccttgtcattaggagatt 35223229  T
458 ctttggtttt 467  Q
    |||| |||||    
35223230 ctttagtttt 35223239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 416
Target Start/End: Original strand, 5858897 - 5858953
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccccta 416  Q
    ||||||||||| ||||||||||||||||||||| | || ||||||||||||| ||||    
5858897 agggttaatagacttttacccccctgccatttgggggttttttggtttacccaccta 5858953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 358 - 413
Target Start/End: Complemental strand, 9307197 - 9307142
Alignment:
358 atagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    |||||||||||||| ||||||||||||||||| || |||| ||||||| |||||||    
9307197 atagggttaataggtttttacccccctgccatatgggcgtattttggtataccccc 9307142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 360 - 415
Target Start/End: Original strand, 21382481 - 21382536
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||||||||||| ||||||||||||| || | |||||||||| |||||||||    
21382481 agggttaataggctttcacccccctgccatatgggggtcttttggtatacccccct 21382536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 360 - 415
Target Start/End: Original strand, 9305620 - 9305675
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    ||||||||||||||||||||||||||| ||||  | | ||||||||||||| ||||    
9305620 agggttaataggcttttacccccctgctatttaggagacttttggtttacctccct 9305675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 361 - 410
Target Start/End: Original strand, 7538261 - 7538310
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttacc 410  Q
    |||||||||| ||||||||  ||||| ||||| |||||||||||||||||    
7538261 gggttaatagacttttaccttcctgctatttgggcgtcttttggtttacc 7538310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0262 (Bit Score: 39; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0262
Description:

Target: scaffold0262; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 355 - 413
Target Start/End: Complemental strand, 4440 - 4382
Alignment:
355 taaatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    |||| |||||||||||||||||| |||| ||||||||| | ||||||||||||||||||    
4440 taaaaagggttaataggcttttatccccttgccatttgggggtcttttggtttaccccc 4382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0262; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 360 - 467
Target Start/End: Original strand, 2759 - 2865
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctatgnnnnnnnncttggagattcccccttgtcattattagattct 459  Q
    ||||||||||| |||||| ||||||| ||| || | | ||||||||||||||||||| |        |||||||||||||||||| |||||  |||||||    
2759 agggttaatagacttttatccccctgtcatatgggtgacttttggtttaccccccta-ggaaaaaaacttggagattcccccttgccattagaagattct 2857  T
460 ttggtttt 467  Q
    ||| ||||    
2858 ttgatttt 2865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049 (Bit Score: 39; Significance: 0.000000000001; HSPs: 4)
Name: scaffold0049
Description:

Target: scaffold0049; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 361 - 415
Target Start/End: Original strand, 386 - 440
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||||||||||||||||||||||||||| | | ||||||||||||| ||||    
386 gggttaataggcttttacccccctgccatttgggggacttttggtttacctccct 440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 361 - 413
Target Start/End: Complemental strand, 3471 - 3419
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    |||||||||||  ||||||||||||||||||| ||| | ||||||||||||||    
3471 gggttaatagggctttacccccctgccatttgggcgacatttggtttaccccc 3419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 359 - 409
Target Start/End: Original strand, 1130 - 1180
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttac 409  Q
    |||||||||||||  ||||||||||||||||||| ||| | ||||||||||    
1130 tagggttaatagggctttacccccctgccatttgggcgacatttggtttac 1180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 360 - 413
Target Start/End: Complemental strand, 3977 - 3925
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    ||||||||||||||||||| ||||||||||||| | | ||||||||||| ||||    
3977 agggttaataggcttttac-cccctgccatttgggggacttttggtttatcccc 3925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0061 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: scaffold0061
Description:

Target: scaffold0061; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 359 - 416
Target Start/End: Complemental strand, 11310 - 11253
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccccta 416  Q
    ||||||||||||| ||||||||||||||||| || | ||||||||||||| |||||||    
11310 tagggttaataggtttttacccccctgccatatgggggtcttttggtttatcccccta 11253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 356 - 417
Target Start/End: Complemental strand, 25650063 - 25650002
Alignment:
356 aaatagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccctat 417  Q
    ||||||||||||||||||||||||||||||| || || |||| ||||||| || ||||||||    
25650063 aaatagggttaataggcttttacccccctgcaatatgggcgtattttggtatagccccctat 25650002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000007; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 360 - 415
Target Start/End: Original strand, 29875946 - 29876000
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccccct 415  Q
    |||||||||||||||||||||| |||||||||| ||| | ||||||||||||||||    
29875946 agggttaataggcttttacccc-ctgccatttgggcgacatttggtttacccccct 29876000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 361 - 412
Target Start/End: Original strand, 32953094 - 32953145
Alignment:
361 gggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccc 412  Q
    |||||||||| |||||||||||||||||||||  || |||||| ||||||||    
32953094 gggttaatagacttttacccccctgccatttggacgacttttgatttacccc 32953145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 359 - 413
Target Start/End: Original strand, 27490097 - 27490151
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    ||||||||||||||||||||| ||||| ||| || | |||||||||| |||||||    
27490097 tagggttaataggcttttacctccctgtcatatgggggtcttttggtataccccc 27490151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0484 (Bit Score: 35; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0484
Description:

Target: scaffold0484; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 359 - 413
Target Start/End: Original strand, 11534 - 11587
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    ||||||||||||||||||| |||||||||||||| | ||||||||| ||||||||    
11534 tagggttaataggctttta-ccccctgccatttgggagtcttttggattaccccc 11587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0484; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 360 - 413
Target Start/End: Complemental strand, 12852 - 12800
Alignment:
360 agggttaataggcttttacccccctgccatttgcgcgtcttttggtttaccccc 413  Q
    ||||||||||||||||||||| || |||||||  | ||||||||||||||||||    
12852 agggttaataggcttttaccctcc-gccatttaggagtcttttggtttaccccc 12800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0408 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0408
Description:

Target: scaffold0408; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 359 - 412
Target Start/End: Original strand, 10085 - 10136
Alignment:
359 tagggttaataggcttttacccccctgccatttgcgcgtcttttggtttacccc 412  Q
    |||||||||||||||||||||||  ||||||||| | |||||||||||||||||    
10085 tagggttaataggcttttacccc--tgccatttgggggtcttttggtttacccc 10136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 850 times since January 2019
Visitors: 1285