View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_high_19 (Length: 441)
Name: NF0095_high_19
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0095_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 383; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 29 - 431
Target Start/End: Original strand, 30450276 - 30450678
Alignment:
| Q |
29 |
aagtcctgtgagggtcaatcaaaatgaggtaattgcattcaactcccttggaaattgaaggtaggttggtgcaattttcccgacaaatgagggtaatgag |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30450276 |
aagtcctgtgagggtcaatcaaaatgaggtaattgcattcaactccctttgaaattgaaggtaggttggtgcaattttcccgacaaatgagggtaatgag |
30450375 |
T |
 |
| Q |
129 |
cttttgtttaaaaaattaaagatgtgtacgtgttatttaagcatacctcaaggggtatgtatgagtgcaacttctccaagcaaaatcaaactttttgttg |
228 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30450376 |
cttttgtttaaaaaatcaaagatgtgtacgtgttatttaagcatacctcatggggtatgtatgagtgcaacttctccaagcaaaatcaaactttttgttg |
30450475 |
T |
 |
| Q |
229 |
ttgaaaaggacagcttttgttactactattattgaaggatgtgctttactgcttttactaaaaacttcttacttatcagttctttatgtactgtggttag |
328 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30450476 |
ttgaaaaagacagcttttgttactactattattgaaggatgtgctttactgcttttactaaaaacttcttacttatcagttctttatgtactgtggttag |
30450575 |
T |
 |
| Q |
329 |
tgggaccaaagcctttagctttttattcatacacttgcattcctatgttgccttttatttacaggatgcccagaaagaatgtcttcttgttaacgcccct |
428 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30450576 |
tgggaccaaagcctttagctttttattcatacacatgcattcctatgttgccttttatttacaggatgcccagaaagaatgtcttcttgttaacgcccct |
30450675 |
T |
 |
| Q |
429 |
ttg |
431 |
Q |
| |
|
||| |
|
|
| T |
30450676 |
ttg |
30450678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University