View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_high_22 (Length: 406)
Name: NF0095_high_22
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0095_high_22 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 30 - 406
Target Start/End: Complemental strand, 3933142 - 3932766
Alignment:
Q |
30 |
gtaatatcctcccatccatattttggagaagatactgaagctttcactctgacccaatctccaacctgatttcagatatattaacaatttaaatacagga |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3933142 |
gtaatatcctcccatccatattttggagaagatactgaagctttcactctgacccaatctccaacctgatttcagatatattaacaatttaaatacagga |
3933043 |
T |
 |
Q |
130 |
aaacaataataaggcattacccagtaagtacaaggtaacaaacttaaaatggaagcaaatgatcaacatcaaccaaaagaattgtcaccttaaaatcttc |
229 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3933042 |
aaacaataataaggcattacgcagtaagtacaaggtaacaaacttaaaatggaagcaaatgatcaacatcaaccaaaagaattgtcaccttaaaatcttc |
3932943 |
T |
 |
Q |
230 |
caccttctccatatcagatggatcagcttgccatggtatgggtcgatttggtatttctattattaagagaccatcattctcaatctcacttattcttcca |
329 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3932942 |
caccttctccatatcagatggatcagcttgccatggtatgggtcgatttggtatttctattattaagagaccatcattctcaatctcacttattcttcca |
3932843 |
T |
 |
Q |
330 |
acactgtgatgtgtctcaccaccccaagcatatctaggttctgcaacagatcgcttcacacataccctatcaccaat |
406 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
3932842 |
acactgtgatgtgtctcaccaccccaagcatatctaggttctgcgacagatcgcttcacacataccctatcaccaat |
3932766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University