View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_high_23 (Length: 374)
Name: NF0095_high_23
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0095_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 317
Target Start/End: Complemental strand, 6626111 - 6625795
Alignment:
Q |
1 |
tgtttatgttgccactaataggtatgtgtaccaaagttaggcaaccagtttgagctattcacttttctctttctcatctggcatccctgaaacatatttt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
6626111 |
tgtttatgttgccactaataggtatgtgtaccaaagttaggcaaccagtttgagctattcacttttctctttctcatctggcatctctgaaacatatttt |
6626012 |
T |
 |
Q |
101 |
cattccttgcagagaaactggagcattgtgtgcaatgaaggaagcagacatattttttgatgatccaaaatctgccgagagtataaagcagttagaacag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6626011 |
cattccttgcagagaaactggagcattgtgtgcaatgaaggaagcagacatattttttgatgatccaaaatctgccgagagtataaagcagttagaacag |
6625912 |
T |
 |
Q |
201 |
gttttcatccatcacttggttgttaatgctgtttatttattatctgtatggtgtatgaagtatgtacatttaaattcactatctgttttatttgttctgt |
300 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6625911 |
gttttcatccatcacttggttgttaatgctgtttatttattatatgtatggtgtatgaagtatgtacatttaaattcactatctgttttatttgttctgt |
6625812 |
T |
 |
Q |
301 |
ctgttggtgtggacact |
317 |
Q |
|
|
||||||||||||||||| |
|
|
T |
6625811 |
ctgttggtgtggacact |
6625795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University