View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_high_39 (Length: 290)
Name: NF0095_high_39
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0095_high_39 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 15 - 290
Target Start/End: Original strand, 50742263 - 50742541
Alignment:
| Q |
15 |
tatgccaagcagttacattaggaatgtgttct---tcttcttctccttcctgtccatctacttccatgtatttctcaaatcctctgatcatggcctccat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50742263 |
tatgccaagcagttacattaggaatgtgttcttcttcttcttctccttcctgtccatctacttccatgtacttctcaaatcctctgatcatggcctccat |
50742362 |
T |
|
| Q |
112 |
agctaccttaagagacttcttgttacccttaagccctcgttgtgcagatgatacggcttgttgagacccaccatcagcagtggcagagcccatcaaagca |
211 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50742363 |
agctaccttaagagactttttgttacccttaagccctcgttgtgcagatgatacggcttgttgagacccaccatcagcagtggcagagcccatcaaagca |
50742462 |
T |
|
| Q |
212 |
tctactttctgctcagcaccggcaacactctcttgttcagcaaactgaatccaagcatcatcaagcctgtcttcaacat |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50742463 |
tctactttctgctcagcaccggcaacactctcttgttcagcaaactgaatccaagcatcatcaagcctgtcttcaacat |
50742541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 998 times since January 2019
Visitors: 1289