View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_high_40 (Length: 279)
Name: NF0095_high_40
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0095_high_40 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 39 - 230
Target Start/End: Original strand, 32605257 - 32605448
Alignment:
Q |
39 |
gcacagacggcacaccatagtaaatttggtgatctcactggcatcacatgatggaaatgaaatgttaatctgcaaattataccgaatacaactcaatgac |
138 |
Q |
|
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
32605257 |
gcactgacggcacaccatagtaaatttgatgatctcactggcatcacatgatggaaatgaaatgttaatttgcaaattataccgaatacaactcaatgac |
32605356 |
T |
|
Q |
139 |
taatccattttcattgtatagtgtggataaaggtacacaattttctaatcacaaaaaacaactgattatctaagtgtttgcatgtacaccat |
230 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32605357 |
taatccattttcattgtgtagtgtggataaaggtacacaattttctaatcacaaaaaacaactgattatctaagtgtttgcatgtacaccat |
32605448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2882 times since January 2019
Visitors: 8723