View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_high_47 (Length: 264)
Name: NF0095_high_47
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0095_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 25644014 - 25644185
Alignment:
| Q |
1 |
taagtatcgatcttaatctaaatgatgaactaatttcatgatattagaataattacaaaactgagatcagatcaagataaagaaaaatggaaacctgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25644014 |
taagtatcgatcttaatctaaatgatgaactaatttcatgatattagaataattacaaaactgagatcagatcaagataaagaaaaatggaaacctgaat |
25644113 |
T |
 |
| Q |
101 |
aagagatagggttccgaataggagcagagaaaagagaagcaacgacgtcgtttttgccatcggtttgttttg |
172 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25644114 |
aagagatagggttccgaagaggaacagagaaaagagaagcaacgacgtcgtttttgccatcagtttgttttg |
25644185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University