View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_high_59 (Length: 207)
Name: NF0095_high_59
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0095_high_59 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 84 - 207
Target Start/End: Original strand, 50742518 - 50742641
Alignment:
Q |
84 |
catcatcaagcctgtcttcaacatgtgccggtgctgtcgctagaccaaagaaaaacccattttcttcttctgcaaaagtaaataaataagccatgtttat |
183 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50742518 |
catcatcaagcctgtcttcaacatgcgccggtgctgtcgctagaccaaagaaaaacccattttcttcttctgcaaaagtaaataaataagccatgtttat |
50742617 |
T |
|
Q |
184 |
attggctcatttgaacttacatac |
207 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
50742618 |
attggctcatttgaacttacatac |
50742641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 17149 times since January 2019
Visitors: 1266