View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_low_42 (Length: 335)
Name: NF0095_low_42
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0095_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 99 - 332
Target Start/End: Original strand, 32990684 - 32990917
Alignment:
| Q |
99 |
ggtggcctcactagcaagccaacaacagagcttcataggtggagttgcagttggcaacagaggataaagagcaagggcggtgattgcgagggtaaatggc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
32990684 |
ggtggcctcactagcaagccaacaacagagcttcataggtggagttgcagttggcaacagaggataaagagcaagggcagtgattgcgagggtaaatgac |
32990783 |
T |
 |
| Q |
199 |
aattgagaattggcatcattgttctctacaatgctgcatctcttgggaagtccacaatgatagatttagtggaaacttgtgaattgggaagttgaggttt |
298 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32990784 |
aattgagaattggcatcattgttctctacgatgctgcatctcttgggaagtccacaatgatagatttagtggaaacttgtgaattgggaagttgaggttt |
32990883 |
T |
 |
| Q |
299 |
gaatagattcaccaaccttgaatcaacaagacta |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32990884 |
gaatagattcaccaaccttgaatcaacaagacta |
32990917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 217 - 258
Target Start/End: Original strand, 32982303 - 32982344
Alignment:
| Q |
217 |
ttgttctctacaatgctgcatctcttgggaagtccacaatga |
258 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
32982303 |
ttgttctctaccatgctgcacctcttgggaagtccacgatga |
32982344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University