View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_low_55 (Length: 292)
Name: NF0095_low_55
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0095_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 45 - 287
Target Start/End: Original strand, 49472634 - 49472877
Alignment:
| Q |
45 |
gatcaaatggcaaaatagagggaaacaatgttaatgtttctaaggtacgagaacccc-ccgacaccgacttggttcatcgatttatcttttgttatttga |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49472634 |
gatcaaatggcaaaatagagggaaacaatgttaatgtttctaaggtacgagaacccccccgacaccgacttggttcatcgatttatcttttgttatttga |
49472733 |
T |
 |
| Q |
144 |
atgcctcatgtattttgaaattattattattgtaggaagaggaaattgaaatcgttgatgaaacggagaaatctaggacaaaaaaggatcttgtcaagaa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49472734 |
atgcctcatgtattttgaaattattattattgtaggaagtggaaattgaaatcgttgatgaaacggagaaatctaggacaaaaaaggatcttgtcaagaa |
49472833 |
T |
 |
| Q |
244 |
taagaattcaaaattgccaagtcctagaggtcttcgtatgactt |
287 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49472834 |
taacaattcaaaattgccaagtcctagaggtcttcgtatgactt |
49472877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University