View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0095_low_60 (Length: 276)
Name: NF0095_low_60
Description: NF0095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0095_low_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 42342018 - 42341796
Alignment:
| Q |
1 |
cttgatcatatatacataagaatttcaaataattcatacatttgtggatacataattttagatttaagtataatatgattggttaaaatttcaggaacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42342018 |
cttgatcatatatacataagaatttcaaataattcatacatttgtggatacataattttagatt-aagtataatatgattggttaaaatttcaggaacct |
42341920 |
T |
 |
| Q |
101 |
gttttctggctctagatcttgctgctgactctctattcttgatcatcctcctctgccttctctccaccaccctttcaacaggaccatcaaccatcctctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42341919 |
gttttctggctctagatcttgctgctgactctctattcttgatcatcctcctctgccttctctccaccaccctttcaacaggaccatcaaccatcctctt |
42341820 |
T |
 |
| Q |
201 |
tcttcctcgtaaaccattcatatc |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42341819 |
tcttcctcgtaaaccattcatatc |
42341796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University