View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0096-Insertion-4 (Length: 240)
Name: NF0096-Insertion-4
Description: NF0096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0096-Insertion-4 |
 |  |
|
[»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 28 - 240
Target Start/End: Original strand, 35244319 - 35244531
Alignment:
Q |
28 |
tatgatcataatgtatgcacaagaatacatgacaatataaaaataataagtttttcagacattacttggtaggttgtctcgttcggatgttgggaagtta |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35244319 |
tatgatcataatgtatgcacaagaatacatgacaatataaaaataataagtttttcagacattacttggtaggttgtctcgttcggatgttgggaagtta |
35244418 |
T |
 |
Q |
128 |
ctttttctaaaggatccagtcgctgcactattgtaattgagcgtgctgcaaaatctgcaagtaatttatatcaaccgagtaatatgcagaaagagtgcac |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35244419 |
ctttttctaaaggatccagtcgctgcactattgtaattgagcgtgctgcaaaatctgcaagtaatttatatcaaccgagtaatatgcagaaagagtgcac |
35244518 |
T |
 |
Q |
228 |
caaggtatttatg |
240 |
Q |
|
|
||||||||||||| |
|
|
T |
35244519 |
caaggtatttatg |
35244531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 106
Target Start/End: Original strand, 35242275 - 35242350
Alignment:
Q |
30 |
tgatcataatgtatgcacaagaatacatgacaatataaaaataataagtttttcagacattacttggtaggttgtct |
106 |
Q |
|
|
|||| |||||||||| ||| ||||||||| | ||||||| ||||||| ||||||| ||| ||| |||||||||||| |
|
|
T |
35242275 |
tgataataatgtatggacacaaatacatgagagtataaaattaataag-ttttcaggcataactcggtaggttgtct |
35242350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University