View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0096-Insertion-6 (Length: 190)
Name: NF0096-Insertion-6
Description: NF0096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0096-Insertion-6 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 7 - 190
Target Start/End: Complemental strand, 34059939 - 34059756
Alignment:
| Q |
7 |
acgcgagccaacattgcaggctctcttcaatctccgcagtgcttttcagttgtccacctgacttcctgaataaacttgataatatgataatgaaaatcga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34059939 |
acgcgagccaacattgcaggctctcttcaatctccgcagtgcttttcagttgtccacctgacttcctgaataaacttgataatatgataatgaaaatcga |
34059840 |
T |
|
| Q |
107 |
tgcactcttgagccccatgaacatccttgaatgtttttatcttcattcatactgttttaacagcatgcttcactcgattaacta |
190 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34059839 |
tgcactctcgagccccatgaacatccttgaatgtttttatcttcattcatactgttttaacagcatgcttcactggattaacta |
34059756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 128 - 190
Target Start/End: Original strand, 22232520 - 22232582
Alignment:
| Q |
128 |
catccttgaatgtttttatcttcattcatactgttttaacagcatgcttcactcgattaacta |
190 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||| |||| |||| |||| |||| |
|
|
| T |
22232520 |
catccttgaatgtttttatcttcattccaactgttttgacagcctgctccactggattcacta |
22232582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 822 times since January 2019
Visitors: 1285