View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0096-Insertion-6 (Length: 190)

Name: NF0096-Insertion-6
Description: NF0096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0096-Insertion-6
NF0096-Insertion-6
[»] chr6 (1 HSPs)
chr6 (7-190)||(34059756-34059939)
[»] chr3 (1 HSPs)
chr3 (128-190)||(22232520-22232582)


Alignment Details
Target: chr6 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 7 - 190
Target Start/End: Complemental strand, 34059939 - 34059756
Alignment:
7 acgcgagccaacattgcaggctctcttcaatctccgcagtgcttttcagttgtccacctgacttcctgaataaacttgataatatgataatgaaaatcga 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34059939 acgcgagccaacattgcaggctctcttcaatctccgcagtgcttttcagttgtccacctgacttcctgaataaacttgataatatgataatgaaaatcga 34059840  T
107 tgcactcttgagccccatgaacatccttgaatgtttttatcttcattcatactgttttaacagcatgcttcactcgattaacta 190  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
34059839 tgcactctcgagccccatgaacatccttgaatgtttttatcttcattcatactgttttaacagcatgcttcactggattaacta 34059756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 128 - 190
Target Start/End: Original strand, 22232520 - 22232582
Alignment:
128 catccttgaatgtttttatcttcattcatactgttttaacagcatgcttcactcgattaacta 190  Q
    |||||||||||||||||||||||||||  |||||||| ||||| |||| |||| |||| ||||    
22232520 catccttgaatgtttttatcttcattccaactgttttgacagcctgctccactggattcacta 22232582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University