View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0096-Insertion-7 (Length: 88)
Name: NF0096-Insertion-7
Description: NF0096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0096-Insertion-7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 3e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 7 - 82
Target Start/End: Original strand, 41751791 - 41751866
Alignment:
Q |
7 |
acaacggtgctcatccctgggttgtagttgaaaactgcaannnnnnnatctaccttgttaatttctaatatcaatt |
82 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
41751791 |
acaacggtgctcatccctgggttgtagttgaaaactgcaatttttttatctaccttgttaatttctaatatcaatt |
41751866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University