View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0096-Insertion-8 (Length: 71)
Name: NF0096-Insertion-8
Description: NF0096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0096-Insertion-8 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 7e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 7e-30
Query Start/End: Original strand, 6 - 71
Target Start/End: Original strand, 40878031 - 40878096
Alignment:
Q |
6 |
caagaactaaccaaagaaattcaacgtattagtaacatttttataatggtgttagtactagtagta |
71 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40878031 |
caagaactaaccaaagaaattcaacgtattagtaacatttttataatggtgttagtactagtagta |
40878096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University