View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0096-Insertion-9 (Length: 55)
Name: NF0096-Insertion-9
Description: NF0096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0096-Insertion-9 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 48; Significance: 3e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 3e-19
Query Start/End: Original strand, 8 - 55
Target Start/End: Complemental strand, 9771750 - 9771703
Alignment:
| Q |
8 |
tcttgcactatactatatccacataccctcccaaccttgacatgttag |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9771750 |
tcttgcactatactatatccacataccctcccaaccttgacatgttag |
9771703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 795 times since January 2019
Visitors: 1284