View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0096_low_16 (Length: 269)

Name: NF0096_low_16
Description: NF0096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0096_low_16
NF0096_low_16
[»] chr7 (2 HSPs)
chr7 (109-237)||(32973560-32973688)
chr7 (28-88)||(32973700-32973759)


Alignment Details
Target: chr7 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 109 - 237
Target Start/End: Complemental strand, 32973688 - 32973560
Alignment:
109 aatcaaggaatatggtgtggggccaaacactgcgtagaatctgtatgaataatcgatgatacgcatatctgctttaacacgtggattgtctttaggtttt 208  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32973688 aatcaaggaatatggtgtggggccaaatactgcgtagaatctgtatgaataatcgatgatacgcatatctgctttaacacgtggattgtctttaggtttt 32973589  T
209 tctcatattttattcactttcatcttcat 237  Q
    | |||||||||||||||||||||||||||    
32973588 tgtcatattttattcactttcatcttcat 32973560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 88
Target Start/End: Complemental strand, 32973759 - 32973700
Alignment:
28 gagaagaagatggaatgttagttgttaagcttaattttgattttattatgtacaacaaatc 88  Q
    ||||||||||||||   ||||||||||||||||||||||||||||||||||| ||||||||    
32973759 gagaagaagatggatacttagttgttaagcttaattttgattttattatgta-aacaaatc 32973700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University