View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0096_low_16 (Length: 269)
Name: NF0096_low_16
Description: NF0096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0096_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 109 - 237
Target Start/End: Complemental strand, 32973688 - 32973560
Alignment:
| Q |
109 |
aatcaaggaatatggtgtggggccaaacactgcgtagaatctgtatgaataatcgatgatacgcatatctgctttaacacgtggattgtctttaggtttt |
208 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32973688 |
aatcaaggaatatggtgtggggccaaatactgcgtagaatctgtatgaataatcgatgatacgcatatctgctttaacacgtggattgtctttaggtttt |
32973589 |
T |
|
| Q |
209 |
tctcatattttattcactttcatcttcat |
237 |
Q |
| |
|
| ||||||||||||||||||||||||||| |
|
|
| T |
32973588 |
tgtcatattttattcactttcatcttcat |
32973560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 88
Target Start/End: Complemental strand, 32973759 - 32973700
Alignment:
| Q |
28 |
gagaagaagatggaatgttagttgttaagcttaattttgattttattatgtacaacaaatc |
88 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32973759 |
gagaagaagatggatacttagttgttaagcttaattttgattttattatgta-aacaaatc |
32973700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1357 times since January 2019
Visitors: 1298