View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0096_low_19 (Length: 226)

Name: NF0096_low_19
Description: NF0096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0096_low_19
NF0096_low_19
[»] chr7 (1 HSPs)
chr7 (52-216)||(40982908-40983072)


Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 52 - 216
Target Start/End: Complemental strand, 40983072 - 40982908
Alignment:
52 cacaaattgggttttctaacgtacctgaccccataaaacattctttgaacgatgaaatgacaggagcagctgtaatgaagaaacaaattccgaaacaaaa 151  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
40983072 cacaaattgggttttctaacgtacctgaccccataaaacattctttgaccgatgaaatgacaggagcagctgtaatgaagaaacaaattccgaaacaaaa 40982973  T
152 gaaactgcatggcatgcccaagagtaccaaactcttgtcaaagcctgatatatctggtctctgtg 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40982972 gaaactgcatggcatgcccaagagtaccaaactcttgtcaaagcctgatatatctggtctctgtg 40982908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University