View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0096_low_19 (Length: 226)
Name: NF0096_low_19
Description: NF0096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0096_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 52 - 216
Target Start/End: Complemental strand, 40983072 - 40982908
Alignment:
| Q |
52 |
cacaaattgggttttctaacgtacctgaccccataaaacattctttgaacgatgaaatgacaggagcagctgtaatgaagaaacaaattccgaaacaaaa |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40983072 |
cacaaattgggttttctaacgtacctgaccccataaaacattctttgaccgatgaaatgacaggagcagctgtaatgaagaaacaaattccgaaacaaaa |
40982973 |
T |
|
| Q |
152 |
gaaactgcatggcatgcccaagagtaccaaactcttgtcaaagcctgatatatctggtctctgtg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40982972 |
gaaactgcatggcatgcccaagagtaccaaactcttgtcaaagcctgatatatctggtctctgtg |
40982908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1174 times since January 2019
Visitors: 1293