View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0097_high_10 (Length: 276)
Name: NF0097_high_10
Description: NF0097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0097_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 11 - 248
Target Start/End: Complemental strand, 38620324 - 38620087
Alignment:
| Q |
11 |
aatgagtgggcatttgatttgctttattgtgtggcatttgtggttatggacaaacagtggttggagacaaacgctacgtacatgcagtttaacgtgagaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38620324 |
aatgagtgggcatttgatttgctttattgtgtggcatttgtggttatggataaacagtggttggagacaaacgctacgtacatgcagtttaacgtgagaa |
38620225 |
T |
 |
| Q |
111 |
tccgtctacttgttatatgattcatgagttccttttaaccttagtcctggatttcaaaattgatgttcatatgtaaaattttgtgtgctttattgaagag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38620224 |
tccgtctacttgttatatgattcatgagttccttttaaccttagtcctggatttcaaaattgatgttcatatgtaaaattttgtgtgctttattgaagag |
38620125 |
T |
 |
| Q |
211 |
gctctttcaaaggggttgaataattgtttctttttcat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38620124 |
gctctttcaaaggggttgaataattgtttctttttcat |
38620087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University