View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0097_high_5 (Length: 404)
Name: NF0097_high_5
Description: NF0097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0097_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 43964319 - 43964012
Alignment:
Q |
1 |
gagaaagttgctttatatgggcttgtatcttctaatatggggtgaagcgtccaatcttcgcttcatgccagagtgtatatgctacatatttcacaatgtg |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43964319 |
gagaaagttgctttatatgggcttgtatcttctcatatggggtgaagcgtccaatcttcgcttcatgccagagtgtatatgctacatatttcacaatgtg |
43964220 |
T |
 |
Q |
101 |
agcacattgttttcatacatttcacagtatcttgggctagattatctttgcatatgaaatgcaactcnnnnnnnnnnattaagaaaaatagtatattaat |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
43964219 |
agcacattgttttcatacatttcacagtatcttgggctagattatctttggatatgaaatgcaactc-tttttttttattaagaaaaatagtatattaat |
43964121 |
T |
 |
Q |
201 |
aatgtttaactctaacttcagatggcatatgaacttcatggtttattggctggaaatgtcagcattgttactggtgaaaatatcaaaccttcttatggtg |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43964120 |
aatgtttaactctaacttcagatggcatatgaacttcatggtttattggctggaaatgtcagcattgttactggtgaaaatatcaaaccttcttatggtg |
43964021 |
T |
 |
Q |
301 |
gtgatgatg |
309 |
Q |
|
|
||||||||| |
|
|
T |
43964020 |
gtgatgatg |
43964012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 74; Significance: 8e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 218 - 307
Target Start/End: Complemental strand, 39166603 - 39166514
Alignment:
Q |
218 |
tcagatggcatatgaacttcatggtttattggctggaaatgtcagcattgttactggtgaaaatatcaaaccttcttatggtggtgatga |
307 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
T |
39166603 |
tcagatggcatatgaactgcatggtttattggctggaaatgtcagcattgtcactggtgaaaatatcaagccttcttatggtggagatga |
39166514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 5 - 102
Target Start/End: Complemental strand, 39166833 - 39166736
Alignment:
Q |
5 |
aagttgctttatatgggcttgtatcttctaatatggggtgaagcgtccaatcttcgcttcatgccagagtgtatatgctacatatttcacaatgtgag |
102 |
Q |
|
|
||||||||||||||||| ||||||||||| || |||||||||||||| ||| |||| ||||||||||||||| | ||||| ||||||||||||||||| |
|
|
T |
39166833 |
aagttgctttatatgggattgtatcttctcatttggggtgaagcgtcaaatgttcgattcatgccagagtgtctgtgctatatatttcacaatgtgag |
39166736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University