View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0097_high_7 (Length: 304)
Name: NF0097_high_7
Description: NF0097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0097_high_7 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 86 - 304
Target Start/End: Complemental strand, 38620821 - 38620599
Alignment:
Q |
86 |
gctgttgctggcgtaaatattactttcatgattatgcaaatgttagaccttgatgcagcaagtatgtcatgtggatgagcct----ttctatcactatgc |
181 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
38620821 |
gctgttgctggcgtaaatattactttcatgattatgcaaatgttagaccttgatgcagcaagtatgtcatgtggatgagcctgcctttctatcactatgc |
38620722 |
T |
 |
Q |
182 |
tttgtgttccaaagatatttaatgcatgtatggaattggcggtgaatttgacaaaatcacaatgctaaattgtgaatccgacagattcactgtcaatccc |
281 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||| |||||||| |
|
|
T |
38620721 |
attgtgttccaaagatatttaatgcatgtatggaattggcggtgaatttgacaaaatcacagtgctacattgtgattccgacagattcaccgtcaatcca |
38620622 |
T |
 |
Q |
282 |
aatgtgcacttatacacttgctt |
304 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
38620621 |
aatgtgcacttatacacttgctt |
38620599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University