View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0097_high_7 (Length: 304)

Name: NF0097_high_7
Description: NF0097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0097_high_7
NF0097_high_7
[»] chr3 (1 HSPs)
chr3 (86-304)||(38620599-38620821)


Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 86 - 304
Target Start/End: Complemental strand, 38620821 - 38620599
Alignment:
86 gctgttgctggcgtaaatattactttcatgattatgcaaatgttagaccttgatgcagcaagtatgtcatgtggatgagcct----ttctatcactatgc 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||    
38620821 gctgttgctggcgtaaatattactttcatgattatgcaaatgttagaccttgatgcagcaagtatgtcatgtggatgagcctgcctttctatcactatgc 38620722  T
182 tttgtgttccaaagatatttaatgcatgtatggaattggcggtgaatttgacaaaatcacaatgctaaattgtgaatccgacagattcactgtcaatccc 281  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||| ||||||||     
38620721 attgtgttccaaagatatttaatgcatgtatggaattggcggtgaatttgacaaaatcacagtgctacattgtgattccgacagattcaccgtcaatcca 38620622  T
282 aatgtgcacttatacacttgctt 304  Q
    |||||||||||||||||||||||    
38620621 aatgtgcacttatacacttgctt 38620599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1473 times since January 2019
Visitors: 1299