View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0097_high_9 (Length: 277)
Name: NF0097_high_9
Description: NF0097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0097_high_9 |
 | |
|
| [»] scaffold0066 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0066 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 38 - 196
Target Start/End: Original strand, 22116 - 22274
Alignment:
| Q |
38 |
ccctagctgttgctgactgatgtaaagatctccgtggaagcaaaggagaaatatttaccggtgggggcaatatgcctacatgatcattgaaacctggaac |
137 |
Q |
| |
|
|||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22116 |
ccctagatgttgcggactgatgtaaagatcttcgtggaagcaaaggagaaatatttaccggtgggggcaatatgcctacatgatcattgaaacctggaac |
22215 |
T |
|
| Q |
138 |
cggaacagagccaaaaattggaattgtggacggattaaatggtggtgcagaagctgaaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22216 |
cggaacagagccaaaaattggaattgtggacggattaaatggtggtgcagaagctgaaa |
22274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University