View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0097_low_11 (Length: 277)

Name: NF0097_low_11
Description: NF0097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0097_low_11
NF0097_low_11
[»] scaffold0066 (1 HSPs)
scaffold0066 (38-196)||(22116-22274)


Alignment Details
Target: scaffold0066 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: scaffold0066
Description:

Target: scaffold0066; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 38 - 196
Target Start/End: Original strand, 22116 - 22274
Alignment:
38 ccctagctgttgctgactgatgtaaagatctccgtggaagcaaaggagaaatatttaccggtgggggcaatatgcctacatgatcattgaaacctggaac 137  Q
    |||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22116 ccctagatgttgcggactgatgtaaagatcttcgtggaagcaaaggagaaatatttaccggtgggggcaatatgcctacatgatcattgaaacctggaac 22215  T
138 cggaacagagccaaaaattggaattgtggacggattaaatggtggtgcagaagctgaaa 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22216 cggaacagagccaaaaattggaattgtggacggattaaatggtggtgcagaagctgaaa 22274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1525 times since January 2019
Visitors: 1302