View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0097_low_5 (Length: 405)
Name: NF0097_low_5
Description: NF0097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0097_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 302
Target Start/End: Original strand, 43964295 - 43964596
Alignment:
| Q |
1 |
caagcccatataaagcaactttctctgttgtatctcttgctgaccttgaggaagtctgtttgaatgaacaagataagcatatttagcacaaaatttctag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43964295 |
caagcccatataaagcaactttctctgttgtatctcttgctgaccttgaggaagtctgtttgaatgaacaagataagcatatttagcacaaaatttctag |
43964394 |
T |
 |
| Q |
101 |
tttatttatttattaaaattttgatgaggaaaaattatataaatatttgctaagcgaagtactgcatagctcaccgtaaactatgttttcgtcccaaaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43964395 |
tttatttatttattaaaattttgatgaggaaaaattatataaatatttgctaagcaaagtacttcatagctcaccgtaaactatgttttcgtcccaaaaa |
43964494 |
T |
 |
| Q |
201 |
tttgcaccatgttttgtaattcttaaagagatcagtcatcactgaattgaccgcgcggtcatcaagctgcaattgtaggaaagaccagtggaatataact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43964495 |
tttgcaccatgttttgtaattcttaaagagatcagtcatcactgaattgaccgcgcggtcatcaagctgcaattgtaggaaagaccagtggaatataact |
43964594 |
T |
 |
| Q |
301 |
at |
302 |
Q |
| |
|
|| |
|
|
| T |
43964595 |
at |
43964596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 170 - 227
Target Start/End: Original strand, 39166983 - 39167040
Alignment:
| Q |
170 |
ctcaccgtaaactatgttttcgtcccaaaaatttgcaccatgttttgtaattcttaaa |
227 |
Q |
| |
|
||||||| |||||||| || |||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
39166983 |
ctcaccgcaaactatgcttccgtcccaagaatttgcaccacgttttgtaattcttaaa |
39167040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 5 - 59
Target Start/End: Original strand, 39166817 - 39166871
Alignment:
| Q |
5 |
cccatataaagcaactttctctgttgtatctcttgctgaccttgaggaagtctgt |
59 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||| ||||||||||||| ||||||| |
|
|
| T |
39166817 |
cccatataaagcaacttcctctgctgtatgtctggctgaccttgaggcagtctgt |
39166871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University