View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0097_low_7 (Length: 305)
Name: NF0097_low_7
Description: NF0097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0097_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 32 - 276
Target Start/End: Original strand, 30370480 - 30370728
Alignment:
| Q |
32 |
gtgtgtgaagaatttggagacaagaaatacgatgatgaagaatctcaatatcttctccaagaaacctaagccaaaaggttccttctttatcattccattc |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
30370480 |
gtgtgtgaagaatttggagacaagaaatacgatgatgaagaatctcaatatcttctccaagaaacctaagccaaaaggttcattctttatcatt-cattc |
30370578 |
T |
 |
| Q |
132 |
gatcactcactttctcatgttttgtctttcttcttctgttctgttccttccactgtcattcaatttt-----attaaaacaaccatttttctattaacan |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30370579 |
gatcactcactttctcatgttttgtctttcttcttctgttctgttccttccaccgtcattcaattttgcttgattaaaacaaccatttttctattaacac |
30370678 |
T |
 |
| Q |
227 |
nnnnnntctctatccatgcagaggttctgagagagagtaaacgtgaaatg |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30370679 |
cccccctctctatccatgcagaggttctgagagagagtaaacgtgaaatg |
30370728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University