View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0098_high_5 (Length: 316)
Name: NF0098_high_5
Description: NF0098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0098_high_5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 31 - 316
Target Start/End: Complemental strand, 24589740 - 24589453
Alignment:
| Q |
31 |
atataaggacagagtataatgcatgaacatgccataatggctgccaaataccattgtcagttgtacgtgcacctatggttaaaacactgcaatttttgtc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24589740 |
atataaggacagagtataatgcatgaacatgccataatggctgccaaataccattgtcagttgtacgtgcacctatggttaaaacactgcaatttttgtc |
24589641 |
T |
|
| Q |
131 |
taacaaatacataaagttatgtagttatggccctagttgtctttggttttgggctattggattttggttgagataaggtat--atattgggtgagatatt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24589640 |
taacaaatacataaagttatgtagttatggccctagttgtctttggttttgggctattggattttggttgagataaggtatatatattgggtgagatatt |
24589541 |
T |
|
| Q |
229 |
taacgtagaagtgaaactcattaactatgtaggatcaattaaaggacatgaagaacaatcatgtgtcctgtccctttcaatggtttca |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24589540 |
taacgtagaagtgaaactcattaactatgtaggatcaattaaaggacatgaagaacaatcatgtgtcctgtccctttcaaaggtttca |
24589453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1034 times since January 2019
Visitors: 1289