View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0098_low_13 (Length: 257)
Name: NF0098_low_13
Description: NF0098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0098_low_13 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 26 - 257
Target Start/End: Complemental strand, 33445720 - 33445489
Alignment:
Q |
26 |
gacatcatctacagggaagaaggccattgttgccccatattctggacacatgtttgcaatcgtagccctatcaggtaacgacagttcaccaacgccttca |
125 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33445720 |
gacatcatctacagggaagaaggccattgttgccccatattctggacacatgtttgcaatcgtagccctatcaggtaacgacagttcaccaacgccttca |
33445621 |
T |
 |
Q |
126 |
ccttaagatatatttaaataggctcactcatttgtgcagatgttgtgaaagttgttcataaactctatcctatgcagtctcatcatataattaacttacc |
225 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33445620 |
ccttaagatatatttaaataggctcactcatttgtgcagatgttgtgaaagttgttcttaaactctatcctatgcagtctcatcatataattaacttacc |
33445521 |
T |
 |
Q |
226 |
gtaaaattcaatgaatttgccaacaacaccat |
257 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
33445520 |
ctaaaattcaatgaatttgccaacaacaccat |
33445489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 41 - 155
Target Start/End: Original strand, 40560106 - 40560222
Alignment:
Q |
41 |
gaagaaggccattgttgccccatattctggacacatgtttgcaatcgtagccctatcaggtaacgacagttcaccaacgccttcaccttaag--atatat |
138 |
Q |
|
|
||||||| ||||||||| | | |||| | |||||||||||||||| || |||| ||||||||| |||||||| ||||||||||| |||||| |||||| |
|
|
T |
40560106 |
gaagaagaccattgttgtctcgtattatcaacacatgtttgcaatcctatccctgtcaggtaacaacagttcatcaacgccttcaacttaaggcatatat |
40560205 |
T |
 |
Q |
139 |
ttaaataggctcactca |
155 |
Q |
|
|
|||||||| |||||||| |
|
|
T |
40560206 |
ttaaatagactcactca |
40560222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1436 times since January 2019
Visitors: 1299