View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0098_low_15 (Length: 251)
Name: NF0098_low_15
Description: NF0098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0098_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 98 - 168
Target Start/End: Original strand, 47156937 - 47157007
Alignment:
| Q |
98 |
gattgggtttagtaaccagggtaaagttgacgtttaaatttgatcatctgtttaaattatgtttcaattac |
168 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47156937 |
gattgggtttagtaacaagggtaaagttgacgtttaaatttgatcatctgtttaaattatgtttcaattac |
47157007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 174 - 223
Target Start/End: Original strand, 47157076 - 47157125
Alignment:
| Q |
174 |
ttaaaatgaatgaatgctgacggttacaattgggctctcgacttgtttgt |
223 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
47157076 |
ttaaaatgaatgaatgttgacagttacaattgggctctcgacttgtttgt |
47157125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 44 - 77
Target Start/End: Original strand, 47156883 - 47156916
Alignment:
| Q |
44 |
ttgggcacacagtatgaaattgaagaagatggtg |
77 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
47156883 |
ttgggcacagagtatgaaattgaagaagatggtg |
47156916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1291 times since January 2019
Visitors: 1296