View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0098_low_8 (Length: 273)
Name: NF0098_low_8
Description: NF0098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0098_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 23929733 - 23929911
Alignment:
Q |
1 |
gtttggcagatgaatgaagagggtagttttgttttgggttctagaggtttaggggaaaagagaggttatttgatgaattgtaatgatattggtatttcac |
100 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23929733 |
gtttggaagatgaatgaagagggtagttttgttttgggttctagaggtttaggggaaaagagaggttatttgatgaattgtaatgatattggtatttcac |
23929832 |
T |
 |
Q |
101 |
atgaagaagatctgagaagtaacaaggtttcagctgtatattatgatgatacagagttatcagagatgtttgatgatgt |
179 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23929833 |
atgaagaagatctgagaagaaacaaggtttcagctgtttattatgatgatacagagttatcagagatgtttgatgatgt |
23929911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 685 times since January 2019
Visitors: 1282