View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0098_low_9 (Length: 266)
Name: NF0098_low_9
Description: NF0098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0098_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 49 - 222
Target Start/End: Original strand, 30769303 - 30769476
Alignment:
Q |
49 |
ttagttgttcgacttatgttctaacacattagttttttgagtgttgaaacactcttatcaaatcaaatttacttaagtgagagcatagtttggttatttg |
148 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30769303 |
ttagttgttcgacttatgttctaatacattagttttttgagtgttgaaacactcttatcaaatcaaatttacttaagtgagagcatagtttggttatttg |
30769402 |
T |
 |
Q |
149 |
tacgatgagtaaattcactagtcttgtattttcttactttggtttgctgaaatgaatgcatatataggatgcaa |
222 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30769403 |
tacgatgagtaaattcactagtcttgtaatttcttactttggtttgctgaaatgaatgcatatataggatgcaa |
30769476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University