View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0099_low_3 (Length: 367)
Name: NF0099_low_3
Description: NF0099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0099_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 7e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 80 - 213
Target Start/End: Complemental strand, 52464709 - 52464576
Alignment:
Q |
80 |
cagcacagacagaacccaaaaccccacctatagaactggtcaagtcggatccgatccacgattgtgattctcatgatgaggagaatagcaaaccgatgat |
179 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
52464709 |
cagcacaaacagaacccaaaaccccacctatagaactggtcaagtcggatccgatccacgattgtgattctgatgatgaggagaatagcaaaccgatgat |
52464610 |
T |
 |
Q |
180 |
gaagaaatcagcgagcgagaaagagtgttcaatg |
213 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
52464609 |
gaagaaatcagcgagcgagaaagagtgttcaatg |
52464576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University