View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0099_low_7 (Length: 212)

Name: NF0099_low_7
Description: NF0099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0099_low_7
NF0099_low_7
[»] chr4 (1 HSPs)
chr4 (19-84)||(50755797-50755862)


Alignment Details
Target: chr4 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 19 - 84
Target Start/End: Complemental strand, 50755862 - 50755797
Alignment:
19 aaaatagacatggtattcatttatagatgggaacgttgaaacactgaagcatatccattctgtgct 84  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
50755862 aaaatagacatggtattcatttatagatgggaacgttgaaacactgaagcatatccattctttgct 50755797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University